SRSM1 synthetic decoy vs. scrambled transfections in MDA-MB-231 cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Hani Goodarzi
PROVIDER: E-GEOD-35749 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:In order to test the transcriptome-wide functionality of the identified sRSE instances, we performed an in vivo titration experiment in which synthetic RNA oligonucleotides harboring tandem sRSE1 repeats were used as intracellular decoys that would bind the putative trans factor, preventing it from targeting endogenous transcripts. Capped and poly-adenylated RNAs carrying tandem sRSE elements were transfected along with scrambled RNA molecules as control. 48 hours post-transfection, samples were subjected to transcriptome profiling to measure the regulatory consequences of the in-vivo titration of the sRSE-binding trans factor.
2014-07-24 | E-GEOD-49609 | biostudies-arrayexpress
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:Decoding post-transcriptional regulatory programs underlying gene expression is a crucial step toward a predictive dynamical understanding of cellular state transitions. Despite recent systematic efforts, the sequence determinants of such mechanisms remain largely uncharacterized. An important obstacle in revealing these elements stems from the contribution of local secondary structures in defining interaction partners in a variety of regulatory contexts, including but not limited to transcript stability, alternative splicing and localization. There are many documented instances where the presence of a structural regulatory element dictates alternative splicing patterns (e.g. human cardiac troponin T) or affects other aspects of RNA biology. Thus, a full characterization of post-transcriptional regulatory programs requires capturing information provided by both local secondary structures and the underlying sequence. We have developed a computational framework based on context-free grammars and mutual information that systematically explores the immense space of structural elements and reveals motifs that are significantly informative of genome-wide measurements of RNA behavior. The application of this framework to genome-wide mammalian mRNA stability data revealed eight highly significant elements with substantial structural information, for the strongest of which we showed a major role in global mRNA regulation. Through biochemistry, mass-spectrometry, and in vivo binding studies, we identified HNRPA2B1 as the key regulator that binds this element and stabilizes a large number of its target genes. Ultimately, we created a global post-transcriptional regulatory map based on the identity of the discovered linear and structural cis-regulatory elements, their regulatory interactions and their target pathways. This approach can also be employed to reveal the structural elements that modulate other aspects of RNA behavior. This SuperSeries is composed of the following subset Series: GSE35749: sRSM1 synthetic decoy vs. scrambled transfections in MDA-MB-231 cells GSE35753: HNRPA2B1 RIP-chip GSE35756: Whole-genome decay rate measurements in MDA-MB-231 cells transfected with HNRPA2B1 siRNAs versus controls GSE35757: siRNA-mediated HNRPA2B1 knock-down in MDA-MB-231 cells GSE35799: HNRPA2B1 HITS-CLIP Refer to individual Series
2012-02-28 | E-GEOD-35800 | biostudies-arrayexpress
Project description:Transcriptional profiling of MDA-MB-231 comparing the regulatory consequences of transfecting synthetic decoys carring sRSM1 motifs versus synthetic scrambled oligos
2012-02-28 | GSE35749 | GEO
Project description:Dual-color transcriptional profiling of decoy-transfected cells, harboring AAAA[AGT]TT motif, versus scrambled-transfected cells as controls.
2009-11-04 | GSE18844 | GEO
Project description:Rett syndrome (RTT) is an X-linked dominant neurodevelopmental disorder caused by mutations in MECP2, encoding methyl-CpG-binding protein 2. MeCP2 is a transcriptional repressor elevated in mature neurons and is predicted to be required for neuronal maturation by regulating multiple target genes. Identifying primary gene targets in either Mecp2-deficient mice or human RTT brain has proven to be difficult, perhaps because of the transient requirement for MeCP2 during neuronal maturation. In order to experimentally control the timing of MeCP2 expression and deficiency during neuronal maturation, human SH-SY5Y cells undergoing mature neuronal differentiation were transfected with methylated MeCP2 oligonucleotide decoy to disrupt the binding of MeCP2 to endogenous targets. Genome-wide expression microarray analysis identified all four known members of the inhibitors of differentiation or inhibitors of DNA-binding (ID1, ID2, ID3 and ID4) subfamily of helix-loop-helix genes as novel neuronal targets of MeCP2. Chromatin immunoprecipitation analysis confirmed binding of MeCP2 near or within the promoters of ID1, ID2 and ID3, and quantitative RT-PCR confirmed increased expression of all four Id genes in Mecp2-deficient mouse brain. All four ID proteins were significantly increased in Mecp2-deficient mouse and human RTT brain using immunofluorescence and laser scanning cytometric analyses. Because of their involvement in cell differentiation and neural development, ID genes are ideal primary targets for MeCP2 regulation of neuronal maturation that may explain the molecular pathogenesis of RTT.
2007-10-26 | E-GEOD-4600 | biostudies-arrayexpress
Project description:Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells. MDA-MB-231 cells were treated with scrambled SID control, 2.5µM SID peptide or untreated for 24h.
2016-07-21 | GSE84648 | GEO
Project description:Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells. MDA-MB-231 cells were treated with scrambled SID control, 2.5µM SID peptide or untreated for 24h. Sub-confluent cultures of MDA-MB-231 cells were treated with scrambled SID control, 2.5µM SID peptide or untreated for 24h. Experiments were performed as three independent replicates.
2016-07-21 | E-GEOD-84648 | biostudies-arrayexpress
