Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression data from embryos injected with DrC1q-like morpholino and control morpholino

ABSTRACT: Except complement C1q, the immunological functions of other C1q family members have remained unclear. In vitro studies showed that DrC1q-like could inhibit the apoptosis induced by ActD and CHX in EPC cells, through repressing the activation of caspase 3/9. Moreover, its physiological roles were studied by morpholino-mediated knockdown in zebrafish embryogenesis We used microarrays to compare the global programme of gene expression of DrC1q-like deficient embryos and control embryos. And identified distinct classes of up-regulated and down-regulated genes in DrC1q-like deficient embryos. Keywords: time course

ORGANISM(S): Danio rerio

PROVIDER: GSE8800 | GEO | 2007/12/29

SECONDARY ACCESSION(S): PRJNA102105

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Transcription profiling of zebrafish embryos injected with DrC1q-like morpholino and control morpholino

Project description:Except complement C1q, the immunological functions of other C1q family members have remained unclear. In vitro studies showed that DrC1q-like could inhibit the apoptosis induced by ActD and CHX in EPC cells, through repressing the activation of caspase 3/9. Moreover, its physiological roles were studied by morpholino-mediated knockdown in zebrafish embryogenesis; We used microarrays to compare the global programme of gene expression of DrC1q-like deficient embryos and control embryos. And identified distinct classes of up-regulated and down-regulated genes in DrC1q-like deficient embryos. Experiment Overall Design: Zebrafish embryos were selected at 24hpf for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain expression profiles of DrC1q-like deficient embryos compared to the control. And we could find out which genes and pathways were affected by DrC1q-like

2008-06-16 | E-GEOD-8800 | biostudies-arrayexpress

Transcription profiling of zebrafish embryos injected with a morpholino targeting LIN9

Project description:TÜAB zebrafish were maintained at 28.5 °C in in 1x Danieau solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca (NO3)2, 5 mM HEPES, pH 7.6, 0.0001 % Methylene blue). Morpholinos (Gene Tools, Philomath, OR) were designed against Danio rerio lin-9 homolog (Genebank accession NM_001044946). The morpholino (MO) sequences were MO-E1 5´-GTTAGTTTTATTACTCACTCTCGTC-3´ and 5-base mismatch morpholino MO-E1mis 5´-GTTACTTTTAATACTGACTGTCCTC-3´. 7 ng of morpholinos were injected into one cell-stage embryos. 20 embryos per condition (MO E1; MO E1mis) were pooled for RNA purification 24 h post fertilization. Using the two color Quick-Amp Labeling Kit (Agilent; 5190-0444) 100 ng of total RNA were used for cDNA synthesis, mRNA amplification and labeling according to manufacturers instructions. Transcriptional profiling was done on a zebrafish oligo array (Agilent; G2519F AMADID 019161) in a 4 x 44K slide format and analyzed as described before.<br>

2009-03-28 | E-MEXP-2100 | biostudies-arrayexpress

Xenopus laevis embryos and animal caps: Control vs PouV morpholino

2013-11-12 | GSE47578 | GEO

RNA-seq of HNRNPAB morpholino in zebrafish

Project description:To investigate the transcriptomic alterations following 24hpf knockdown of the gene HNRNPAB in zebrafish, we injected HNRNPAB morpholino with 3ng and 6ng into 1-cell zebrafish embryos separately, and the 24hpf embryos were collected for RNA-seq.

2022-03-31 | GSE199586 | GEO

Xenopus laevis embryos and animal caps: Control vs PouV morpholino

Project description:Transcriptional profiling of Xenopus laevis embryos and ectoderm (animal caps) comparing embryos injected with control morpholino with embryos injected with the morpholino mixture PVD2, which knocks down all three Xenopus PouV proteins. Whole embryos (WE) or animal caps (AC) were collected at late blastula (9) or early gastrula (10) stages from Control and PVD2 morphants. Two conditions: Control vs. PouV morpholino; Two tissues: whole embryos, animal caps .Two timepoints: stage 9 and 10. Biological replicates: 2 control replicates at stage 9 and 10 for whole embryos, 2 control replicates at stage 9 and 10 for animal caps, 2 PVD2 morpholino replicates at stage 9 and 10 for whole embryos, 2 control replicates at stage 9 and 10 for animal caps

2013-11-12 | E-GEOD-47578 | biostudies-arrayexpress

Zebrafish 22 hpf embryos: WT vs. MO-grnA injected

2013-03-28 | GSE28318 | GEO

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Differential gene expression in 2 days old zebrafish after glucocerebrosidase (GBA1) morpholino-mediated knockdown

Project description:Gene expression signature was explored to identify gene targets regulate by dysfunctional glucocerebrosidase function. We found 131 upregulated genes and 63 downregulated genes. Some of the most upregulated (PON3, PLOD1) and downregulated (gpx-1b and complemewnt c9) genes were analyzed by q-PCR demonstrating the correct differential gene expression signature among control and morpholino-microinjected fish. Knockdown of GBA1 function was measured in 4 biological replicates at 2 days post fertilization after microinjection of GBA1 morpholino and control morpholino at one -cell stage embryos.

2014-02-07 | E-GEOD-54754 | biostudies-arrayexpress

WT vs MO-grnA injected: 16, 24, 48, 72 hpf trunk region of zebrafish embryos

Project description:Transcriptional profiling of zebrafish embryo comparing wild type untreated embryos with embryos injected with morpholino of zf-grna. This assay is used for determination of expression profiling of trunk muscle at 16, 24, 48, 72 hpf under GRN-A deficiency.

2013-06-01 | GSE38441 | GEO

Zebrafish 22 hpf embryos: WT vs. MO-grnA injected

Project description:Transcriptional profiling of zebrafish embryos comparing wild type untreated embryos with embryos injected with morpholino of zf-grna. This assay is used for the determination of expression profiling at 22 hpf under GRN-A deficiency. Two-condition experiment: wild type vs. MO-grnA treated cells. 3 biological replicates: each group contains 200 embryos.

2013-03-28 | E-GEOD-28318 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data