S2 cell expression data following DmSTING knockdown and cyclic ci-GMP transfection
Ontology highlight
ABSTRACT:
ORGANISM(S): Drosophila melanogaster
PROVIDER: GSE90443 | GEO | 2018/06/19
REPOSITORIES: GEO
Similar Datasets
Project description:S2 cells were treated with dsRNA targeting dSTING (dSTING RNAi) or non-specifically (control). 90-mer dsDNA (dsDNA90) was then transfected, which activates dSTING. Mock transfection was performed in the absence of dsDNA90 using lipofectamine alone. Affymetrix arrays were used to profile gene expression.
2015-09-22 | GSE54832 | GEO
Project description:The activity of many proteins orchestrating different biological processes is regulated by allostery, where ligand binding at one site alters the function of another site. Allosteric changes can be brought about by either a change in the dynamics of a protein, or alteration in its mean structure. We have investigated the mechanisms of allostery induced by chemically distinct ligands in the cGMP-binding, cGMP-specific phosphodiesterase, PDE5. PDE5 is the target for catalytic site inhibitors, such as sildenafil, that are used for the treatment of erectile dysfunction and pulmonary hypertension. PDE5 is a multidomain protein and contains two N-terminal cGMP-specific phosphodiesterase, bacterial adenylyl cyclase, FhLA transcriptional regulator (GAF) domains, and a C-terminal catalytic domain. Cyclic GMP binding to the GAFa domain and sildenafil binding to the catalytic domain result in conformational changes, which to date have been studied either with individual domains or with purified enzyme. Employing intramolecular bioluminescence resonance energy transfer, which can monitor conformational changes both in vitro and in intact cells, we show that binding of cGMP and sildenafil to PDE5 results in distinct conformations of the protein. Metal ions bound to the catalytic site also allosterically modulated cGMP- and sildenafil-induced conformational changes. The sildenafil-induced conformational change was temperature-sensitive, whereas cGMP-induced conformational change was independent of temperature. This indicates that different allosteric ligands can regulate the conformation of a multidomain protein by distinct mechanisms. Importantly, this novel PDE5 sensor has general physiological and clinical relevance because it allows the identification of regulators that can modulate PDE5 conformation in vivo.
| S-EPMC3048737 | biostudies-literature
Project description:Transcriptional profiling in HACAT cells using a whole human genome array HACAT cells treated with si RNA against Keap 1 or a scrambled si RNA sequence (Scram) vs HACAT cells mock transfected with lipofectamine (reference control)
2009-08-30 | GSE17011 | GEO
Project description:Gene expression of murine repeatedly activated Th1 cells 36h, 48h and 72h after miR-31 inhibition using a specific antagomir (Antagomir-31) compared to a scrambled controll (Antagomir-SCR).
2018-12-19 | GSE122223 | GEO
Project description:Cyclic dinucleotides are an important class of signaling molecules that regulate a wide variety of pathogenic responses in bacteria, but tools for monitoring their regulation in vivo are lacking. We have designed RNA-based fluorescent biosensors for cyclic di-GMP and cyclic AMP-GMP by fusing the Spinach aptamer to variants of a natural GEMM-I riboswitch. In live cell imaging experiments, these biosensors demonstrate fluorescence turn-on in response to cyclic dinucleotides, and they were used to confirm in vivo production of cyclic AMP-GMP by the enzyme DncV.
| S-EPMC3775879 | biostudies-literature
Project description:The cyclic dinucleotides 3'-5'diadenylate (c-diAMP) and 3'-5' diguanylate (c-diGMP) are important bacterial second messengers that have recently been shown to stimulate the secretion of type I Interferons (IFN-Is) through the c-diGMP-binding protein MPYS/STING. Here, we show that physiologically relevant levels of cyclic dinucleotides also stimulate a robust secretion of IL-1β through the NLRP3 inflammasome. Intriguingly, this response is independent of MPYS/STING. Consistent with most NLRP3 inflammasome activators, the response to c-diGMP is dependent on the mobilization of potassium and calcium ions. However, in contrast to other NLRP3 inflammasome activators, this response is not associated with significant changes in mitochondrial potential or the generation of mitochondrial reactive oxygen species. Thus, cyclic dinucleotides activate the NLRP3 inflammasome through a unique pathway that could have evolved to detect pervasive bacterial pathogen-associated molecular patterns associated with intracellular infections.
| S-EPMC3807221 | biostudies-literature
Project description:Adenylyl cyclases are widely distributed across all kingdoms whereas guanylyl cyclases are generally thought to be restricted to eukaryotes. Here we report that the α-proteobacterium Rhodospirillum centenum secretes cGMP when developing cysts and that a guanylyl cyclase deletion strain fails to synthesize cGMP and is defective in cyst formation. The R. centenum cyclase was purified and shown to effectively synthesize cGMP from GTP in vitro, demonstrating that it is a functional guanylyl cyclase. A homologue of the Escherichia coli cAMP receptor protein (CRP) is linked to the guanylyl cyclase and when deleted is deficient in cyst development. Isothermal calorimetry (ITC) and differential scanning fluorimetry (DSF) analyses demonstrate that the recombinant CRP homologue preferentially binds to, and is stabilized by cGMP, but not cAMP. This study thus provides evidence that cGMP has a crucial role in regulating prokaryotic development. The involvement of cGMP in regulating bacterial development has broader implications as several plant-interacting bacteria contain a similar cyclase coupled by the observation that Azospirillum brasilense also synthesizes cGMP when inducing cysts.
| S-EPMC4273943 | biostudies-literature
Project description:We compared the transcriptomes of S. flexneri strains expressing the diguanylate cyclase VCA0956 (derived from V. cholerae)
2021-09-01 | GSE173759 | GEO
Project description:In certain structural or functional contexts, RNA structures can contain protonated nucleotides. However, a direct role for stably protonated nucleotides in ligand binding and ligand recognition has not yet been demonstrated unambiguously. Previous X-ray structures of c-GAMP binding riboswitch aptamer domains in complex with their near-cognate ligand c-di-GMP suggest that an adenine of the riboswitch either forms two hydrogen bonds to a G nucleotide of the ligand in the unusual enol tautomeric form or that the adenine in its N1 protonated form binds the G nucleotide of the ligand in its canonical keto tautomeric state. By using NMR spectroscopy we demonstrate that the c-GAMP riboswitches bind c-di-GMP using a stably protonated adenine in the ligand binding pocket. Thereby, we provide novel insights into the putative biological functions of protonated nucleotides in RNA, which in this case influence the ligand selectivity in a riboswitch.
| S-EPMC6140456 | biostudies-literature
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen).
2014-07-22 | GSE51441 | GEO