Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Fat body and midgut transcriptome of Wild-type vs. transgenic Aedes aegypti overexpressing JAK/STAT pathway components

ABSTRACT: We have developed genetically modified Ae. aegypti mosquitoes that activate the conserved antiviral JAK/STAT pathway in the fat body tissue, by overexpressing either the receptor Dome or the Janus kinase Hop by the blood feeding-induced vitellogenin (Vg) promoter. Transgene expression inhibits infection with several dengue virus (DENV) serotypes in the midgut as well as systemically and in the salivary glands. The impact of the transgenes Dome and Hop on mosquito longevity was minimal, but it resulted in a compromised fecundity when compared to wild-type mosquitoes. Overexpression of Dome and Hop resulted in profound transcriptome regulation in the fat body tissue as well as the midgut tissue, pinpointing several expression signatures that reflect mechanisms of DENV restriction. Our transcriptome studies and reverse genetic analyses suggested that enrichment of DENV restriction factor and depletion of DENV host factor transcripts likely accounts for the DENV inhibition, and they allowed us to identify novel factors that modulate infection. Interestingly, the fat body-specific activation of the JAK/STAT pathway did not result in any enhanced resistance to Zika virus (ZIKV) or chikungunya virus (CHIKV) infection, thereby indicating a possible specialization of the pathway’s antiviral role.

ORGANISM(S): Aedes aegypti

PROVIDER: GSE90515 | GEO | 2016/11/26

SECONDARY ACCESSION(S): PRJNA354948

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

RNA sequencing of Aedes mosquitoes infected with Zika virus (ZIKV) or Dengue virus (DENV)

Project description:Zika virus (ZIKV), a pathogen of global health concern, is transmitted to humans by Aedes mosquitoes. However, the molecular interactions between the vector and the virus remain largely unexplored. We demonstrated that ZIKV and dengue virus (DENV) have similar tropism and infection kinetics in two mosquito strains with different degrees of susceptibility to infection. Comparison of Aedes aegypti’s molecular responses to ZIKV and DENV infection indicated that around 40% of the mosquito’s infection-responsive transcriptome is virus-specific. Regulated genes also included key factors of the mosquito’s anti-viral immunity, pointing to the possible involvement of the Toll innate immune pathway. Comparison of ZIKV and DENV infection-responsive transcriptome data to those for yellow fever virus and West Nile virus identified 26 genes likely to play key roles in virus infection of Aedes mosquitoes. Through reverse genetic analyses, we showed that the Toll and the Jak/Stat innate immune pathways mediate increased resistance to ZIKV infection, and the virus use vATPase and inosine-5’-monophosphate dehydrogenase as mosquito’s host factors.

2017-11-07 | GSE96605 | GEO

A Dicistrovirus-specific inducible antiviral response in Drosophila

Project description:The fruit fly Drosophila melanogaster is a good model to unravel the molecular mechanisms of innate immunity, and has led to some important discoveries on the sensing and signalling of microbial infections. The response of drosophila to virus infections remains poorly characterized, and appears to involve two facets. On one hand RNA interference (RNAi) involves the recognition and processing of dsRNA into small interfering (si) RNAs by the host ribonuclease Dicer-2 (Dcr-2), whereas on the other hand an inducible response controlled by the evolutionarily conserved JAK/STAT pathway contributes to the antiviral host defence. In order to clarify the contribution of the siRNA and JAK/STAT pathways to the control of viral infections, we have compared the resistance of flies wild-type or mutant for Dcr-2 or the JAK kinase Hopscotch (Hop) to infections by seven RNA or DNA viruses belonging to different families. Our results reveal a unique susceptibility of hop mutant flies to infection by DCV and CrPV, two members of the Dicistroviridae family. Genome-wide microarray analysis confirmed that different sets of genes were induced following infection by DCV (GSE2828) or two unrelated RNA viruses, FHV and SINV. Overall, our data reveal that RNAi is an efficient antiviral mechanism, operating against a large range of viruses, including a DNA virus. By contrast, the antiviral contribution of the JAK/STAT pathway appears to be virus-specific.

2013-02-06 | GSE31542 | GEO

Fat body-derived cytokine Upd2 regulates the polarity of Drosophila tracheal stem cells [RNA-seq]

Project description:Adult stem cells are essential for maintaining tissue homeostasis. We employ Drosophila tracheal progenitors to understand the mechanism controlling the polarity of stem cell migration. Here, we show that polarity of tracheal progenitors depends on the function of fat body. Cytokine, Upd2, produced by fat body, signals to tracheal progenitors and activation JAK/STAT signal transduction. Perturbation of Upd2 production or loss-of-function of JAK/STAT signaling in the trachea cause aberrant bidirectional migration of tracheal progenitors. JAK/STAT signaling promotes the expression of a series of genes involved in planar cell polarity, which generates asymmetric localization of Fat and Pod1. Furthermore, the transport of Upd2 requires Rab5-, Rab7-mediated endocytic sorting and Lbm-dependent vesicle trafficking, where vesicular Upd2 functionally interacts with Rabs, Tetraspanin and Grasp65. These results reveal an inter-organ communication in which cytokines from fat body direct the polarity of ectodermal origin tracheal progenitors and suggest that Upd2-dependent JAK/STAT signaling regulates anterior-posterior polarity of tracheal progenitor movement.

2024-10-28 | GSE256177 | GEO

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

A Dicistrovirus-specific inducible antiviral response in Drosophila

2013-02-06 | E-GEOD-31542 | biostudies-arrayexpress

Interactome of DENV2 NS1 and NS5 in Aedes albopictus mosquito cells

Project description:Efficient virus replication in its vector, Aedes mosquitoes, is essential for the transmission of arboviral diseases like dengue virus (DENV) in populations. In order to identify RNA-independent host factors involved in DENV replication in mosquitoes, we established a system expressing all non-structural proteins within the context of the macro protein complex as observed during viral infections. Mosquito host factors interacting with 3xFLAGED-tagged DENV non-structural proteins NS1 or NS5 proteins were identified by label-free mass spectrometry.

2022-08-25 | PXD031112 | Pride

Interaction proteomics of Loqs-GFP in Aedes after Dengue infection

Project description:Efficient virus replication in its vector, Aedes mosquitoes, is essential for the transmission of arboviral diseases like dengue virus (DENV) in populations. In order to identify RNA-independent host factors involved in DENV replication in mosquitoes, we established a system expressing all non-structural proteins within the context of the macro protein complex as observed during viral infections. We GFP-tagged Loqs to purify it's interactors by label-free mass spectrometry.

2022-08-10 | PXD035419 | Pride

Aedes aegypti

Project description:Fat body and midgut transcriptome of Wild-type vs. transgenic Aedes aegypti overexpressing JAK/STAT pathway components

| PRJNA354948 | ENA

SAGE analysis reveals variation in midgut transcriptomes of dengue-2 susceptible and refractory Aedes aegypti mosquitoes

Project description:Oral susceptibility of Aedes aegypti mosquitoes to dengue viruses varies between different Aedes species and strains. However, the midgut-specific transcriptional profile that may produce this variation is presently obscure and was the subject of our investigation. The variation in active expression between dengue-2 susceptible (SUS) and refractory (REF) mosquitoes was investigated during the first critical 96 hours after infection Transcriptional profiles were mined from respective guts using the serial analysis of gene expression technique (SAGE) and libraries constructed from midguts obtained from mosquitoes that received a dengue-2 infected blood meal (DENV-2), a non infected blood meal (naive) or a 5% sucrose meal (SM). Here we report that variation between DENV-2 infected libraries versus respective naïve libraries revealed very few transcripts that were common and statistically significant in DENV-2 infected libraries. In addition, the expression profiles among libraries displayed up regulation of antisense transcripts especially in the SUS strain. A strong proclivity towards strain-specificity in differential expression was observed, which suggested an exclusive transcription that is likely up-regulated after DENV-2 infection

2013-09-30 | GSE14384 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data