Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Beta-adrenergically stimulated RNA expression in Syk deficient brown adipocytes

ABSTRACT: Cre recombinase activity was induced in differentiating brown adipocytes from CreERT2 Sykflox/flox mice in vitro, which resulted in a partial loss of Syk protein in mature brown adipocytes. Such cells were viable, morphologically normal and displayed largely normal gene expression as indicated by mRNA sequencing and qPCR analysis, suggesting that Syk is not required for survival and gene expression of terminally differentiated brown adipocytes. mRNA sequencing of Syk depleted brown adipocytes treated with 0.1 microM isoproterenol for 6 h showed that 2460 genes were not induced or suppressed upon stimulation. Gene set enrichment analysis revealed a great enrichment for genes essential for mitochondrial respiration and biogenesis, for genes associated with and required for adipogenesis, as well as for genes responsive to various stimuli in adipocytes among genes highly ranked by reduced fold changes in response to isoproterenol in the Syk deficient brown adipocytes.

OTHER RELATED OMICS DATASETS IN: PRJNA356837

ORGANISM(S): Mus musculus

PROVIDER: GSE91081 | GEO | 2017/12/09

SECONDARY ACCESSION(S): PRJNA356837

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

TREM2 Drives Microglia Response to Amyloid-β via SYK-dependent and -independent Paths [SYK and TREM2 scRNA-seq]

Project description:Genetic studies have highlighted microglia as pivotal in orchestrating Alzheimer’s disease (AD). Microglia that adhere to Aβ plaques acquire a transcriptional signature, “diseaseassociated microglia” (DAM), which largely emanates from the TREM2-DAP12 receptor complex that transmits intracellular signals through the protein tyrosine kinase SYK. The human TREM2R47H variant associated with high AD risk fails to activate microglia via SYK. We found that SYK-deficient microglia cannot encase Aβ plaques, accelerating brain pathology and behavioral deficits. SYK deficiency impaired the PI3K-AKT-GSK3β-mTOR pathway, incapacitating anabolic support required for attaining the DAM profile. However, SYK-deficient microglia proliferated and advanced to an Apoe-expressing prodromal stage of DAM; this pathway relied on the adaptor DAP10, which also binds TREM2. Thus, microglial responses to Aβ involve non-redundant SYK- and DAP10-pathways. Systemic administration of an antibody against CLEC7A, a receptor that directly activates SYK, rescued microglia activation in mice expressing the TREM2R47H allele, unveiling new options for AD immunotherapy.

2022-10-10 | GSE195518 | GEO

Transcriptome profiling of brown adipocytes treated with BML-260, DMSO or ISO for revealing the BML-260 mechanism

Project description:To explore BML-260 how to increase thermogenesis, we treated brown adipocytes with BML-260 and DMSO for 1 day or 3 days after seven days' differenciation. Meanwhile, we also set ISO (isoproterenol)-treated brown adipocytes as positive control. We found that BML-260 treatment led to very significant upregulation of genes involved in oxidative phosphorylation, fatty acid beta-oxidation, and mitochondrial function.When compared to cells treated with ISO, although both showed significant upregulation of UCP1, BML-260-treated cells showed a rather distinct gene profile when compared to ISO-treated cells. This work provides evidences that BML-260 can also exert a JSP-1-independent effect in activating UCP1 and thermogenesis in adipocytes, and be potentially applied to treat obesity.

2019-04-16 | GSE129791 | GEO

Pseudodesulfovibrio strain:SYK

Project description:Pseudodesulfovibrio sp. SYK

| PRJDB14204 | ENA

SYK activity modulates the EGFR-dependent transcriptome

Project description:Background: Among all gynecologic malignancies, epithelial ovarian cancer has the highest case-to-fatality ratio. Most patients are diagnosed at advanced stages and recurrence is common and accounts for disease-related mortality. Spleen tyrosine kinase (SYK) is an emerging cancer-associated kinase upregulated in recurrent tumors and is amenable for inhibition using small compounds that have been studied in clinical trials for autoimmune diseases. Our previous proteomic analysis identified several novel SYK substrates including EGFR and ERBB2. Here, we investigated the cross-talk between these pathways in ovarian carcinomas. Methods: Immunohistochemistry and immunoblotting were utilized to assess SYK and EGFR phosphorylation in ovarian serous carcinomas. Association with survival was determined by Kaplan-Meier analysis and the log-rank test. To study its role in EGFR signaling, SYK activity was modulated using a small molecule inhibitor, a syngeneic knockout, and an active kinase inducible system. We applied RNA-seq to investigate the SYK-regulated EGF-induced transcriptome. Results: Intense immunoreactivity of active pSYK(Y525/526) correlated with poor overall survival in two independent ovarian cancer cohorts. SYK directly phosphorylated EGFR and ERBB2, while knockout of SYK reduces their phosphorylation. Phosphorylation levels of SYK(Y525/526) positively correlated with EGFR(Y1187) and STAT3(Y705). Active SYK reduced sensitivity to the EGFR/ERBB2 inhibitor, lapatinib, and SYK non-phosphorylatable EGFR mutant was more sensitive to paclitaxel. SYK modulated the EGF-induced transcriptome, supporting its involvement in EGFR/ERBB2-regulated transcriptional activity. Conclusions: Our findings suggest an upstream role of SYK in regulating the EGFR/ERBB2 signaling, and provide a biological rationale for targeting SYK in ovarian cancer therapy.

2020-11-08 | GSE106716 | GEO

TREM2 Drives Microglia Response to Amyloid-β via SYK-dependent and -independent Paths [DAP12KI scRNA-seq]

2022-10-10 | GSE210257 | GEO

Derivation and Characterization of a UCP1 Reporter Human ES Cell Line

Project description:Interest in human brown fat as a novel therapeutic target to tackle the growing obesity and diabetes epidemic has increased dramatically in recent years. While much insight into brown fat biology has been gained from murine cell lines and models, few resources are available to study human brown fat in-vitro. In this study, we detail the derivation and characterization of a novel human ES UCP1 reporter cell line that marks UCP1 positive adipocytes in-vitro. We targeted a mCherry reporter to the UCP1 stop codon via CRISPR-Cas9 and demonstrated that when differentiated to brown adipocytes, reporter cells express UCP1, display high mitochondrial content and multi-locular lipid morphology, and exhibit functional properties such as lipolysis in the presence of isoproterenol and forskolin. Isolation and purification of mCherry positive cells demonstrated elevated expression of brown fat marker genes and a high similarity to isolated human brown fat versus white fat via RNA-seq. This reporter cell line thus presents new opportunities to study human brown fat biology by enabling future work to understand early human brown fat development, performing disease modeling, and enabling drug screening applications.

2020-07-27 | GSE109163 | GEO

Loss of Syk in normal breast cells

Project description:Loss of Syk in normal breast cells in vivo and in vitro: gene expression and phenotypic switch to stem-cell like with induction of invadopodia Morphological and gene microarray analysis following Syk knockdown in MCF10A reveals a loss of luminal and differentiated epithelial features with epithelial to mesenchymal transition and a gain in invadopodia and stem/ progenitor cell marker expression. These results support the role of Syk in limiting normal stem/progenitor proliferation and invasion during morphogenesis, and support the role of Syk as a critical tumor suppressor for breast cancer.

2009-11-20 | GSE16200 | GEO

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

MicroRNAs are required for the feature maintenance and differentiation of brown adipocytes

Project description:Brown adipose tissue is specialized to burn lipids for heat generation as a natural defense against cold and obesity. Previous studies established microRNAs as essential regulators of brown adipocyte differentiation, but it remains unknown whether microRNAs are required for the feature maintenance of mature brown adipocytes. To address this question, we ablated Dgcr8, a key regulator of the microRNA biogenesis pathway, in mature brown as well as white adipocytes. The adipose tissue -specific Dgcr8 knockout mice displayed enlarged but pale interscapular brown fat with decreased expression of genes characteristic of brown fat, and the mice were intolerant to cold exposure. In vitro primary brown adipocyte cultures confirmed that microRNAs are required for marker gene expression in mature brown adipocytes. We also demonstrated that microRNAs are essential for the browning of subcutaneous white adipocyte both in vitro and in vivo. Using this animal model, we performed microRNA expression profiling analysis and identified a set of BAT-specific microRNAs that are up-regulated during brown adipocyte differentiation and enriched in brown fat compared to other organs. We identified miR-182 and miR-203 as new regulators of brown adipocyte development. Taken together, our study demonstrates an essential role of microRNAs in the maintenance as well as the differentiation of brown adipocytes.

2014-08-07 | GSE60165 | GEO

Resistance mechanisms to SYK inhibition in AML

Project description:Targeted therapy studies with small molecules against kinases, such as spleen tyrosine kinase (SYK), are underway in patients with acute myeloid leukemia (AML) and show promising initial results. Identifying the potential mechanism of resistance and finding new drug combinations to overcome them, however, is essential for the long-term success of these targeted agents. Here, we conducted a genome-scale ORF resistance screen and identified activation of the RAS/MAPK/ERK signaling pathway as one major mechanism of resistance to SYK inhibition. This finding was validated in AML cell lines with innate and acquired resistance to a SYK inhibitor and in AML samples from patients who developed resistance to SYK inhibition. In order to circumvent this resistance, we demonstrate the synergistic activity of a MEK Inhibitor in combination with a SYK inhibitor in RAS mutated cells, as well as in entospletinib-resistant AML cells.

2020-01-16 | GSE129698 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data