Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Knock down of C11orf67 by shRNA in SUM52PE

ABSTRACT: SUM52PE cells were lentivirally transduced with PKLO empty vector control (Sigma SHC001 MISSION PLKO.1-PURO CONTROL VECTOR) or shRNA specific for C11orf67 (Sigma Clone ID: NM_024684.2-280s21c1 SHCLND-NM_024684 TRCN0000263814) in biological triplicates. Differentially regulated targets by the shRNA relative to empty vector control were determined.

ORGANISM(S): Homo sapiens

PROVIDER: GSE92893 | GEO | 2020/12/24

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Individual SRC-2 and SRC-3 knock-down in MCF-7 cells

Project description:Experimental aim: identification of SRC-2 and SRC-3-related genes in MCF-7 breast cancer cells. Experimental workflow: 1. shRNA transduction. MCF-7 cells were transduced with a mix of lentiviral particles containing five individual lentiviral pLKO.1-puro short hairpin (sh) RNA plasmids targeting different sequences on SRC-2 or SRC-3 mRNA and a pLKO.1-puro empty vector control. The puromycin selections were maintained for three weeks to obtain cells containing stably integrated shRNA. 2. Sample preparation. RNA was extracted from eight independent replicates expressing the pLKO.1-puro empty shRNA vector (shKTR), from eight replicates of SRC-2 shRNA expressing cells (shSRC-2), and from seven replicates of SRC-3 shRNA expressing cells (shSRC-3). 300 ng of total RNA from each cell sample was biotin-labelled and amplified.

2019-07-01 | E-MTAB-7018 | biostudies-arrayexpress

Knockdown of Znf148 by shRNA in MDA-MB-231 breast cancer cells.

Project description:RNA-Sequencing of basal subtype triple negative breast cancer cells, MDA-MB-231. MDA-MB-231 cells were lentivirally transduced with pLKO short-hairpin (sh) luciferase control or shZnf148 in triplicates. Differentially expressed genes by the shRNA compared to the control were determined.

2022-10-04 | GSE132953 | GEO

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

2017-11-01 | GSE85242 | GEO

Comparison of gene expression changes in AML cells after SMARCA4, SMARCD2 or DPF2 knock-down

Project description:We explored the role of SMARCA4 and the two Brahma associated factors SMARCD2 and DPF2 in leukaemia. We observed the selective requirement for these factors for leukemic cell expansion, as well as extended survival of mice transplanted with leukaemic cells with reduced expression of these genes. Gene expression profiling revealed largely similar alterations with the down-regulation of each of these three factors, suggesting a concerted function in transformed blood cells. These changes included loss of pluripotency-associated signature but did not correlate with c-MYC down-regulation. Human acute monocytic leukemia cells (THP-1, ACC 16) were lentivirally transduced with pLKO-puro vectors carrying shRNAs against SMARCA4, SMARCD2 or DPF2. As a negative control, THP-1 cells were transduced with pLKO-puro-shScr (Scrambled). All samples were prepared as biological triplicates.

2015-07-12 | E-GEOD-67923 | biostudies-arrayexpress

Human tongue squamous cell carcinoma cell line SAS-Control vs. SAS-LYRIC knockdown stable clones global gene profiling

2016-02-28 | GSE44766 | GEO

C/EBPα is crucial determinant of epithelial maintenance by preventing epithelial-to-mesenchymal transition

Project description:RNA-sequencing of human mammary epithelial cells (HMLEs) that were lentivirally transduced with vector that constitutively expresses C/EBPα and its respective empty vector control. Both lines were analyzed with and without TGF-β treatment.

2020-01-15 | GSE143612 | GEO

Downregulation of ARID1B, a tumor-suppressor in the WNT subgroup medulloblastoma, activates multiple oncogenic signaling pathways

Project description:About 85% of WNT subgroup medulloblastomas exhibit the loss of one copy of chromosome 6. Loss of function mutations were identified in the ARID1B gene located on chromosome 6 in WNT subgroup tumors suggesting tumor suppressor role for ARID1B in WNT medulloblastomas. The expression of ARID1B was downregulated in the medulloblastoma cell line Daoy using two independent shRNA sequences in a doxycycline-inducible lentiviral vector tet-pLKO-puro and the effect of its downregulation on the gene expression profile was studied by the RNA-seq analysis

2021-08-26 | GSE163810 | GEO

Human 293T -cGAS-MYO1F-KAT2A,LC-MS

Project description:To identify cGAS acetylation sites, 293T cells coexpressing the PCDH-EGFP-puro empty vector or PCDH-EGFP-puro-Flag-cGAS with KAT2A and MYO1F were subjected to immunoprecipitation with an anti-Flag antibody. After washing four times with IP buffer, the protein was eluted with IP buffer containing 0.1% SDS and analyzed by mass spectrometry.

2024-12-14 | PXD057694 | Pride

Human tongue squamous cell carcinoma cell line SAS-Control vs. SAS-LYRIC knockdown stable clones global gene profiling

Project description:Transcriptional profiling of SAS cells transfected with pLKO.1-LYRIC shRNA-B expression vector (desinaged as B) and control SAS cells (transfected with pLKO.1 vector, designated as CTL). Goal was to determine the effects of LYRIC knockdown on global SAS cells gene expression. Two-condition experiment, SAS cells transfected with pLKO.1-LYRIC shRNA-B expression vector (desinaged as B) v.s. control SAS cells (transfected with pLKO.1 vector, designated as CTL). Biological replicates: 4 control replicates, 4 transfected replicates.

2016-02-28 | E-GEOD-44766 | biostudies-arrayexpress

Lentiviral expression of MiR-31 in CD8 T-cells.

Project description:Purpose: identify genes regulated by expression of miR-31 in primary mouse CD8 T-cells by exogenously expressing pre-miR-31 from the Plko.3g lentiviral vector. Cells infected with empty Plko.3g vectors were used as controls for infection.

2015-11-01 | GSE63549 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data