Dataset Information

In vivo delivery of CRISPR/Cas9 nanocomplexes in post-mitotic neurons for Alzheimer’s disease therapy

ABSTRACT: The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system has emerged as a powerful technique for correcting genetic disease-causing mutations. However, in vivo gene editing using CRISPR/Cas9 remains a major challenge currently limiting its therapeutic application for disease correction. In the present study, we developed novel Cas9/gRNA nanocomplexes that lead to efficient in vivo gene targeting of neurons in the brain. We demonstrate the in vivo efficacy of Cas9-nanocomplexes as therapeutic agents for Alzheimer’s disease (AD) by targeting the BACE1 gene. Remarkably, in vivo BACE1 targeting by using Cas9-nanocomplexes results in decreased Aβ42 production and improvement of cognitive decline in an AD mouse model. These results suggest that Cas9-nanocomplexes represent an effective in vivo gene editing platform in the brain, and that this strategy may be applicable to the treatment of a broad range of neurological diseases.

ORGANISM(S): Mus musculus Homo sapiens

PROVIDER: GSE96065 | GEO | 2020/03/09

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

In vivo delivery of CRISPR/Cas9 nanocomplexes in post-mitotic neurons for Alzheimer’s disease therapy

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets