GNPS - Standards and Controls Relating to Belizean Sediment Metabolome Analysis
Ontology highlight
ABSTRACT:
INSTRUMENT(S): maXis
ORGANISM(S): Sediment Community
SUBMITTER: 
Paul Jensen
PROVIDER: MSV000082128 | GNPS | Tue Mar 06 12:24:00 GMT 2018
REPOSITORIES: GNPS
Similar Datasets
Project description:Standards and controls relating to Belizean sediment metabolome analysis
2018-03-06 | MSV000082128 | MassIVE
Project description:The zebrafish embryo has repeatedly proved to be a useful model for the analysis of effects by environmental toxicants. This study was performed to investigate if an approach combining mechanism-specific bioassays with microarray techniques can obtain more in-depth insights into the ecotoxicity of complex pollutant mixtures as present, e.g., in freeze-dried whole sediment samples and their corresponding organic extracts in parallel. To this end, altered gene expression was compared to data from established bioassays as well as to results from chemical analysis. Microarray analysis revealed several classes of significantly regulated genes which could to a considerable extent be related to the hazard potential. Results indicate that potential classes of contaminants can be assigned to sediment extracts by both classical biomarker genes and corresponding expression profile analyses of known substances. However, it is difficult to distinguish between specific responses and more universal detoxification of the organism. Additionally, different gene expression was shown to be less influenced by the sampling site than by the method of exposure, which could be attributed to differential bioavailability of contaminants. Microarray analyses were performed with early life stages of zebrafish exposed to sediment extracts or freeze-dried sediment from three sampling sites (Ehingen, Lauchert, Sigmaringen) along the Upper part of the Danube River, Germany. The expression profiles were compared within the sampling sites, between the exposure scheme and to the expression pattern of model toxicants, such as 4-chloroaniline, Cadmium, DDT, TCDD, and Valproic acid (Gene Expression Omnibus Series GSE9357). Additionally, mechanism-specific bioassays and chemical analysis of the sediments have been combined and compared to the present gene expression data.
2012-12-31 | E-GEOD-31400 | biostudies-arrayexpress
Project description:The zebrafish embryo has repeatedly proved to be a useful model for the analysis of effects by environmental toxicants. This study was performed to investigate if an approach combining mechanism-specific bioassays with microarray techniques can obtain more in-depth insights into the ecotoxicity of complex pollutant mixtures as present, e.g., in freeze-dried whole sediment samples and their corresponding organic extracts in parallel. To this end, altered gene expression was compared to data from established bioassays as well as to results from chemical analysis. Microarray analysis revealed several classes of significantly regulated genes which could to a considerable extent be related to the hazard potential. Results indicate that potential classes of contaminants can be assigned to sediment extracts by both classical biomarker genes and corresponding expression profile analyses of known substances. However, it is difficult to distinguish between specific responses and more universal detoxification of the organism. Additionally, different gene expression was shown to be less influenced by the sampling site than by the method of exposure, which could be attributed to differential bioavailability of contaminants.
2012-12-31 | GSE31400 | GEO
Project description:The zebrafish embryo has repeatedly proved to be a useful model for the analysis of effects by environmental toxicants. This proof-of-concept study was performed to investigate if an approach combining mechanism-specific bioassays with microarray techniques can obtain more in-depth insights into the ecotoxicity of complex pollutant mixtures as present, e.g., in sediment extracts. For this end, altered gene expression was compared to data from established bioassays as well as to results from chemical analysis. Microarray analysis revealed several classes of significantly regulated genes which could to a considerably extend be related to the hazard potential. Results indicate that potential classes of contaminants can be assigned to sediment extracts by both classical biomarker genes and corresponding expression profile analyses of known substances. However, it is difficult to distinguish between specific responses and more universal detoxification of the organism.
2012-12-31 | GSE30594 | GEO
Project description:Purpose: Determine if gene expression profiles in urine sediment could provide non-invasive candidate markers for painful bladder syndrome (PBS) with and/or without Hunner lesions. Materials and Methods: Fresh catheterized urine was collected and centrifuged from control (n = 5), lesion-free (n = 5), and Hunner lesion bearing (n = 3) patients. RNA was extracted from the pelleted material and quantified by gene expression microarray (Affymetrix Human Gene ST Array). Results: Three biologically likely hypotheses were tested: A) all three groups are distinct from one another; B) controls are distinct from both types of PBS patients combined, and C) Hunner lesion PBS patients are distinct from controls and non-Hunner-lesion PBS combined. For statistical parity an unlikely fourth hypothesis was included: non-Hunner-lesion PBS patients are distinct from controls and Hunner lesion PBS combined. Analyses supported selective upregulation of genes in the Hunner lesion PBS group (hypothesis C), and these were primarily associated with inflammatory function. This profile is similar to that reported in a prior microarray study of bladder biopsies in Hunner lesion PBS. Conclusions: Urine sediment gene expression from non-Hunner-lesion PBS patients lacked a clear difference from that of control subjects, while the array signatures from PBS patients with Hunner lesions showed a clear, primarily inflammatory, signature. This signature was highly similar to that seen in a prior microarray study of bladder biopsies. Thus, although sample sizes were small, this work suggests that gene expression in urine sediment may provide a non-invasive biomarker for Hunner lesion, but not non-Hunner lesion, PBS.
2012-02-06 | GSE28242 | GEO
Project description:Metabolomic analysis of sediment samples specially for glycolipid analysis
2023-07-04 | MSV000092341 | MassIVE
Project description:The zebrafish embryo has repeatedly proved to be a useful model for the analysis of effects by environmental toxicants. This proof-of-concept study was performed to investigate if an approach combining mechanism-specific bioassays with microarray techniques can obtain more in-depth insights into the ecotoxicity of complex pollutant mixtures as present, e.g., in sediment extracts. For this end, altered gene expression was compared to data from established bioassays as well as to results from chemical analysis. Microarray analysis revealed several classes of significantly regulated genes which could to a considerably extend be related to the hazard potential. Results indicate that potential classes of contaminants can be assigned to sediment extracts by both classical biomarker genes and corresponding expression profile analyses of known substances. However, it is difficult to distinguish between specific responses and more universal detoxification of the organism. Microarray analysis were performed with early life stages of zebrafish exposed to 2 sediment extracts from the Upper part of the River Rhine, Germany. The expression profile as then compared to the expression pattern of model toxicants, such as, 4-chloroaniline, Cadmium, DDT, TCDD, and Valproic acid (Gene Expression Omnibus Series GSE9357). Additionally, combining mechanism-specific bioassays as well as chemical analysis of the sediments to the gene expression data has contributed to a more comprehensive view on the hazard potential of the sediments.
2012-12-31 | E-GEOD-30594 | biostudies-arrayexpress
Project description:Lake sediment samples for biosurfactants analysis
2023-07-02 | MSV000092330 | MassIVE
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.
2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress
Project description:International Standards for Cytogenomic Arrays
| PRJNA76081 | ENA