Standards and Controls Relating to Belizean Sediment Metabolome Analysis
Ontology highlight
ABSTRACT:
INSTRUMENT(S): maXis
ORGANISM(S): Sediment Community
SUBMITTER: 
Paul Jensen
PROVIDER: MSV000082128 | MassIVE | Tue Mar 06 12:24:00 GMT 2018
REPOSITORIES: MassIVE
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| MSV000082128 | Other |
Items per page: 5 1 - 1 of 1 |
Similar Datasets
Project description:Standards and controls relating to Belizean sediment metabolome analysis
2018-03-06 | MSV000082128 | GNPS
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.
2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress
Project description:International Standards for Cytogenomic Arrays
| PRJNA76081 | ENA
Project description:International Standards for Cytogenomic Arrays
| PRJNA695810 | ENA
Project description:While the importance of random sequencing errors decreases at higher DNA or RNA sequencing depths, systematic sequencing errors (SSEs) dominate at high sequencing depths and can be difficult to distinguish from biological variants. These SSEs can cause base quality scores to underestimate the probability of error at certain genomic positions, resulting in false positive variant calls, particularly in mixtures such as samples with RNA editing, tumors, circulating tumor cells, bacteria, mitochondrial heteroplasmy, or pooled DNA. Most algorithms proposed for correction of SSEs require a training data set, which is typically either from a part of the data set being “recalibrated” (Genome Analysis ToolKit, or GATK) or from a separate data set with special characteristics (SysCall). Here, we combine the advantages of these approaches by adding synthetic RNA spike-in standards to human RNA, and use GATK to recalibrate base quality scores with reads mapped to the spike-in standards. Compared to conventional GATK recalibration that uses reads mapped to the genome, spike-ins improve the accuracy of Illumina base quality scores by a mean of 5 units, and by as much as 13 units at CpG sites. In addition, since reads mapping to the genome are not used for recalibration, our method allows run-specific recalibration even for the many species without a comprehensive and accurate SNP database. We also use GATK with the spike-in standards to demonstrate that the Illumina RNA sequencing runs overestimate quality scores for AC, CC, GC, GG, and TC dinucleotides, while SOLiD has less dinucleotide SSEs but more SSEs for certain cycles. We conclude that using these DNA and RNA spike-in standards with GATK improves base quality score recalibration.
2012-03-03 | GSE36217 | GEO
Project description:Reference Standards for Mosaic Variant Detection
| PRJNA1007404 | ENA
Project description:Reference Standards for Mosaic Variant Detection
| PRJNA1007405 | ENA
Project description:While the importance of random sequencing errors decreases at higher DNA or RNA sequencing depths, systematic sequencing errors (SSEs) dominate at high sequencing depths and can be difficult to distinguish from biological variants. These SSEs can cause base quality scores to underestimate the probability of error at certain genomic positions, resulting in false positive variant calls, particularly in mixtures such as samples with RNA editing, tumors, circulating tumor cells, bacteria, mitochondrial heteroplasmy, or pooled DNA. Most algorithms proposed for correction of SSEs require a training data set, which is typically either from a part of the data set being M-bM-^@M-^\recalibratedM-bM-^@M-^] (Genome Analysis ToolKit, or GATK) or from a separate data set with special characteristics (SysCall). Here, we combine the advantages of these approaches by adding synthetic RNA spike-in standards to human RNA, and use GATK to recalibrate base quality scores with reads mapped to the spike-in standards. Compared to conventional GATK recalibration that uses reads mapped to the genome, spike-ins improve the accuracy of Illumina base quality scores by a mean of 5 units, and by as much as 13 units M-BM- at CpG sites. In addition, since reads mapping to the genome are not used for recalibration, our method allows run-specific recalibration even for the many species without a comprehensive and accurate SNP database. We also use GATK with the spike-in standards to demonstrate that the Illumina RNA sequencing runs overestimate quality scores for AC, CC, GC, GG, and TC dinucleotides, while SOLiD has less dinucleotide SSEs but more SSEs for certain cycles. We conclude that using these DNA and RNA spike-in standards with GATK improves base quality score recalibration. Four human RNA samples with equimolar ERCC spike-in standards were sequenced on Illumina. Two human brain/liver/muscle RNA mixtures with dynamic range of ERCC spike-in standards were sequenced on SOLiD.
2012-03-03 | E-GEOD-36217 | biostudies-arrayexpress
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards.
2009-06-03 | GSE14695 | GEO
Project description:Mycorrhizae, symbiotic interactions between soil fungi and tree roots, are ubiquitous in terrestrial ecosystems. The fungi contribute phosphorous, nitrogen and mobilized nutrients from organic matter in the soil and in return the fungus receives photosynthetically-derived carbohydrates. This union of plant and fungal metabolisms is the mycorrhizal metabolome. Understanding this symbiotic relationship at a molecular level provides important contributions to the understanding of forest ecosystems and global carbon cycling. We generated next generation short-read transcriptomic sequencing data from fully-formed ectomycorrhizae between Laccaria bicolor and aspen (Populus tremuloides) roots. The transcriptomic data was used to identify statistically significantly expressed gene models using a bootstrap-style approach, and these expressed genes were mapped to specific metabolic pathways. Integration of expressed genes that code for metabolic enzymes and the set of expressed membrane transporters generates a predictive model of the ectomycorrhizal metabolome. Results indicate the specific compounds glycine, glutamate, and allantoin are synthesized by L. bicolor and that these compounds or their metabolites may be used for the benefit of aspen in exchange for the photosynthetically-derived sugars fructose and glucose.The analysis illustrates an approach to generate testable biological hypotheses to investigate the complex molecular interactions that drive ectomycorrhizal symbiosis. These models are consistent with experimental environmental data and provide insight into the molecular exchange processes for organisms in this complex ecosystem. The method used here for predicting metabolomic models of mycorrhizal systems from deep RNA sequencing data can be generalized and is broadly applicable to transcriptomic data derived from complex systems. Fully formed L.bicolor::P.trichocapra mycorrhizae in duplicate
2011-03-25 | E-GEOD-28157 | biostudies-arrayexpress