Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

GNPS - Dataset Creation from GNPS Molcular Networking - 6a8c58a81fad4ab8ae5587b86d3e3070

ABSTRACT: Molino, RJEJ., Rellin, KFB, Nellas, RB., Junio, HA. Small in size, big on taste: Metabolomics analysis of flavor compounds from Philippine garlic. PLoS ONE (2021) 16(5): e0247289. https://doi.org/10.1371/journal.pone.0247289

INSTRUMENT(S): Xevo G2-S QTof

ORGANISM(S): Allium Sativum (ncbitaxon:4682)

SUBMITTER: Hiyas A. Junio

PROVIDER: MSV000088826 | GNPS | Sat Feb 12 08:56:00 GMT 2022

REPOSITORIES: GNPS

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

GNPS - Dataset Creation from GNPS Molcular Networking - 3eb412ec41a149f6a53550db8814ebf9

Project description:Amoroso, VB, Mendez, RA, Junio, HA., Molino, RJEJ, Pescadero, IR., Villalobos, AP. Characterization of a Natural Fungicide from an Indigenous Plant Tasmannia piperita (Hook.f.) Miers Extract: Stability, Metabolomics, and In silico Studies. Philippine Journal of Science (2021). 150 (2): 355-370 Collaboration between Secondary Metabolites Profiling Laboratory (SMPL), Institute of Chemistry, UP Diliman, and Central Mindanao University.

2022-02-12 | MSV000088825 | GNPS

GNPS - Dataset Creation from GNPS Molcular Networking - 6cf9579a41424e28a060626633244fda

Project description:Molino, R.J.E.J.; Rellin, K.F.B.; Nellas, R.B.; Junio, H.A. Sustainable Hues: Exploring the Molecular Palette of Biowaste Dyes through LC-MS Metabolomics. Molecules 2021, 26, 6645. https://doi.org/10.3390/molecules26216645

2022-02-10 | MSV000088813 | GNPS

GNPS - Dataset Creation from GNPS Molcular Networking - 499f3454320146b0ac6caba3b0486ef4

Project description:Combined water, methanol and chloroform soil extracts from week 12 of a California grassland soil root detritus experiment conducted under normal (~16% GWC) and reduced moisture (~8% GWC) conditions.

2024-03-28 | MSV000094429 | GNPS

Comparative genomic hybridization of Schistosoma japonicum Chinese and Philippine isolates

Project description:Chinese and Philippine strains of the blood fluke Schistosoma japonicum present clear and distinctive phenotypes in areas of fecundity, pathology, drug sensitivity and immunology. Despite these differences large scale sequencing efforts have focused solely on Chinese mainland strain of the parasite. We have undertaken a comparative genomic hybridisation (CGH) approach to highlight some of the structural differences in the genome of two of the major geographical isolates of S. japonicum. We identified seven distinct regions of the S. japonicum genome that present differential CGH between Chinese and Philippine strains of the blood fluke Schistosoma japonicum, representing either deletion or duplication regions in the Philippine strain. Within these regions, genes that may be related to phenotypical differences are identified and discussed. Genomic DNA was isolated from adult (7 week post cercarial challenge) Schistosoma japonicum Chinese and Philippine isolates and separate maleand femalesamples comparatively hybridised on an Agilent customn designed oligo microarray.

2012-07-13 | E-GEOD-39329 | biostudies-arrayexpress

Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.

Project description:Small RNA from total RNA (input fraction) and immunoprecipitated HA-AGO1-complexes (IP fraction) were identified using high-throughput sequencing-by-synthesis. Two replicate input fraction samples were used as controls for two replicate IP fraction samples. Total RNA from input fractions and small RNA that co-immunoprecipitated with HA-AGO1 complexes were size fractionated by polyacrylamide gel electrophoresis to recover 18-24 nucleotide small RNA. 3' and then 5' adaptors were serially ligated on to each small RNA followed by PAGE purification. RT-PCR was used to convert RNA to DNA amplicons. Amplicons were sequenced using the Illumina GAIIx platform. Resulting reads were parsed and mapped to the A. thaliana genome (TAIR9) using the CASHX pipeline.

2010-06-21 | E-GEOD-22252 | biostudies-arrayexpress

GNPS - Dataset Creation from GNPS Molcular Networking - 6bd4f858a8704e3fa98cb0c66de02248

Project description:20 Methanol extracts of the hosts/endosclerotia of multiple species of the fungal genus Paraisaria (Ophiocordycipitaceae, Hypocreales). ID codes for the LCMS samples correspond to vouchered specimens as follows: En-1 = OSC-M-052011 En-2 = OSC-M-052009 En-3 = OSC-M-052008 En-4 = OSC-M-052005 En-5 = OSC-M-052007 En-6 = OSC-M-052015 En-8 = OSC-M-052017 En-9 = OSC-M-052016 En-10 = OSC-M-052012 En-11 = K-M 1434269 En-12 = OSC.164134 En-13 = OSC-M-052010 En-14 = OSC-M-052026 En-15 = OSC-M-052013 En-16 = OSC.164137 En-17 = OSC.164135 En-18 = OSC-M-052004 En-19 = OSC-M-052022 En-20 = OSC-M-052020 En-21 = BPI 634610

2023-08-03 | MSV000092591 | GNPS

Distinct epigenetic profiles at the cytosine modification level define epithelial-to-mesenchymal cell-state transitions

Project description:Genome wide DNA methylation and hydroxymethylation profiling of 6 isolated single cell clones and the parental (SUM149-PT) cell line. The Illumina Infinium Human MethylationEPIC Beadchip was used to obtain DNA methylation and hydroxymethylation profiles across approximately 850,000 CpGs in 6 isolated single cell clones that represent the phenotypes of the epithelial-to-mesenchymal spectrum along with the parental (SUM149-PT) cell line. Isolated single cell clones represent varying phenotypes of the epithelial-to-mesenchymal transition. Detailed isolation and characterization methods can be found in Brown et al, 2021. https://doi.org/10.1101/2021.03.17.434993

2022-05-27 | GSE181036 | GEO

Comparative genomic hybridization of Schistosoma japonicum Chinese and Philippine isolates

2012-07-14 | GSE39329 | GEO

MicroRNA-Directed siRNA Biogenesis in Caenorhabditis elegans

Project description:C.elegans small RNAs from HA::ALG-1, HA::ALG-2 and HA::RDE-1 IP and rde-1 mutants

2010-04-14 | GSE20649 | GEO

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data