Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

43 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.

ABSTRACT: Small RNA from total RNA (input fraction) and immunoprecipitated HA-AGO1-complexes (IP fraction) were identified using high-throughput sequencing-by-synthesis. Two replicate input fraction samples were used as controls for two replicate IP fraction samples. Total RNA from input fractions and small RNA that co-immunoprecipitated with HA-AGO1 complexes were size fractionated by polyacrylamide gel electrophoresis to recover 18-24 nucleotide small RNA. 3' and then 5' adaptors were serially ligated on to each small RNA followed by PAGE purification. RT-PCR was used to convert RNA to DNA amplicons. Amplicons were sequenced using the Illumina GAIIx platform. Resulting reads were parsed and mapped to the A. thaliana genome (TAIR9) using the CASHX pipeline.

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: James Carrington

PROVIDER: E-GEOD-22252 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Unique functionality of 22-nt miRNAs in triggering RDR6-dependent siRNA biogenesis from target transcripts in Arabidopsis.

Cuperus Josh T JT Carbonell Alberto A Fahlgren Noah N Garcia-Ruiz Hernan H Burke Russell T RT Takeda Atsushi A Sullivan Christopher M CM Gilbert Sunny D SD Montgomery Taiowa A TA Carrington James C JC

Nature structural & molecular biology 20100618 8

RNA interference pathways can involve amplification of secondary siRNAs by RNA-dependent RNA polymerases. In plants, RDR6-dependent secondary siRNAs arise from transcripts targeted by some microRNAs (miRNAs). Here, Arabidopsis thaliana secondary siRNAs from mRNA as well as trans-acting siRNAs are shown to be triggered through initial targeting by a 22-nucleotide (nt) miRNA that associates with AGO1. In contrast to canonical 21-nt miRNAs, 22-nt miRNAs primarily arise from foldback precursors cont ...[more]

PMID: 20562854

Similar Datasets

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Functional analysis of Arabidopsis ARGONAUTE1 using a slicer-defective mutant: Small RNA immunoprecipitation

Project description:The Arabidopsis ARGONAUTE (AGO) protein AGO1 associates with microRNA (miRNA) and specific classes of short-interfering RNA (siRNA). AGO1-small RNA complexes recognize target RNA transcripts through base-pairing interactions and inhibit translation of target RNAs through endonucleolytic cleavage (slicing) or non-degradative mechanisms. The PIWI domain of AGO1 contains a metal-coordinating triad [Asp-Asp-His] (DDH) that is required for slicer activity. Here, we compared the activities of wild type (DDH) and slicer active-site defective (DAH) forms of AGO1 by sequencing small RNA and target transcript RNAs that co-immunoprecipitated with hemagglutinin (HA)-tagged AGO1 proteins. We found that the population of miRNA that associated with both AGO1-DDH and AGO1-DAH proteins largely overlapped, suggesting that cleavage activity does not affect miRNA maturation. In contrast, slicer-defective AGO1-miRNA complexes associated with target RNA more effectively than did wild type AGO1-miRNA. These data indicate that slicer-defective AGO proteins can be used as an approach to capture AGO-small RNA-target RNA ternary complexes more efficiently for genome-wide analyses. AGO1-DDH (wild type) AGO1-DAH (slicer mutant) proteins were immunoprecipitated (N-terminal 3xHA) from Arabidopsis (Columbia) flower (stages 1-12) lysate. Immunoprecipitations were also done from control plants transformed with vector only. Small RNA from immunoprecipitate fractions of vector, AGO1-DDH and AGO1-DAH were sequenced.

2012-09-28 | E-GEOD-40258 | biostudies-arrayexpress

Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.

Project description:Small RNA from total RNA (input fraction) and immunoprecipitated HA-AGO1-complexes (IP fraction) were identified using high-throughput sequencing-by-synthesis.

2010-06-21 | GSE22252 | GEO

ChIP-seq of Arabidopsis ARGONAUTE-small RNA interactions in Arabidopsis thaliana identified by high-throughput sequencing

Project description:The goal of this study was to identify small RNA-ARGONAUTE interactions in Arabidopsis. Co-immunoprecipitation assays followed by high-throughput sequencing were done to identify small RNA associated with HA-AGO2 and HA-AGO7. Experiment Overall Design: Sequencing-by-synthesis technology was used to sequence small RNA from input and co-immunoprecipitation fractions from cell lysates of inflorescence tissue from Arabidopsis plants transformed with HA epitope-tagged AGO2 or AGO7 constructs. Meaningful intepretation requires comparison between the input and co-immunoprecipitation datasets. Experiment Overall Design: Note: Raw data files requested, however, the submitter declined to provide them.

2009-08-30 | E-GEOD-12037 | biostudies-arrayexpress

AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing

Project description:The goal of this study was to identify AGO1-dependent miRNA and tasiRNA in Arabidopsis by sequencing small RNA from wild type (Col-0) and ago1-25 plants. Keywords: Small RNA Sequencing-by-synthesis technology was used to sequence small RNA from flower tissue (stages 1-12) from wild-type (Col-0) and ago1-25 Arabidopsis thaliana plants. Three biological replicates were sequenced for both Col-0 and ago1-25.

2008-11-17 | E-GEOD-13605 | biostudies-arrayexpress

MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana: Illumina sequencing

Project description:Deep sequencing of small RNA from three closely related brassicaceae A. thaliana, A. lyrata and Capsella rubella was done to systematically analyze the evolution of MIRNA genes and their targets. Small RNA were extracted from total RNA by size fractionation and converted to DNA amplicons by serial adaptor ligation to both ends followed by RT-PCR. DNA amplicons were sequenced using an Ilumina Genome Analyzer. Resulting sequences were computationally trimmed to remove 3' adaptor sequences. Raw data files (fastq) are unavailable for two of the samples (A.lyrata_flowers-stage1-12_rep1 and A.lyrata_flowers-stage1-12_rep2).

2010-05-14 | E-GEOD-20660 | biostudies-arrayexpress

Ago1 vs Ago2-IP small RNA deep-sequencing with age in Drosophila

Project description:Drosophila miRNAs show distinct change in isoform distribution pattern with age. Some miRNAs show accumulation of the short isoforms, while other miRNAs show the accumulation of the long isoforms with age. The increase of the long isoforms of some miRNAs reflects increased 2'-O-methylated miRNA isoforms with age. The increase in 2'-O-methylated miRNA isoforms reflected increased Ago2-loading, but not Ago1-loading of specific miRNA isoforms with age. This raised a question on whether there is global shift in small RNA loading pattern between Ago1 and Ago2 with age. To investigate change in small RNA loading pattern between Ago1 and Ago2 with age, we performed small RNA deep-sequencing of Ago1 vs Ago2-IP small RNAs at 3d and 30d in Drosophila. This analysis revealed global increase of miRNA loading into Ago2, but not into Ago1 with age. 3d and 30d FLAG-HA-Ago2 male flies were collected. Ago1 and Ago2 were immunoprecipitated by anti-Ago1 and anti-FLAG M2 beads respectively. RNA was purified from the beads, P32-labeled, and small RNA fraction was gel-purififed. Small RNA libraries were prepared using Illumina's TruSeq small RNA sample preparation kit (#RS-200-0012, Illumina, Inc. San Diego, CA), following the manufacturer's protocol. The libraries were multiplexed and sequenced on HiSeq2000 platform (Illumina).

2014-01-01 | E-GEOD-52961 | biostudies-arrayexpress

The Arabidopsis F-box protein FBW2 degrades AGO1 to avoid spurious loading of illegitimate small RNA

Project description:RNA silencing is a conserved mechanism in eukaryotes and is involved in development, heterochromatin maintenance and defense against viruses. In plants, ARGONAUTE1 (AGO1) protein plays a central role in both microRNA (miRNA) and small interfering RNA (siRNA)-directed silencing and its expression is regulated at multiple levels. Here, we report that the F-box protein FBW2 targets proteolysis of AGO1 by a CDC48-mediated mechanism. We found that FBW2 assembles an SCF complex that recognizes the MID-PIWI domain of AGO1 and requires its C-terminal domain containing a GW motif for AGO1 turnover. We showed that FBW2 has a preference for the unloaded and for some mutated forms of AGO1 protein. While FBW2 loss of function does not lead to strong growth or developmental defects, it significantly increases RNA silencing activity. Interestingly, under conditions in which small RNA production or accumulation is affected, the failure to degrade AGO1 in fbw2 mutants becomes more deleterious for the plant. Hence, we showed that the non-degradable AGO1 protein assembles high molecular complexes and binds illegitimate small RNA leading to the cleavage of new target genes that belong to stress responses and cellular metabolic processes. Therefore, the control of AGO1 homeostasis by ubiquitin ligases, plays an important quality control to avoid off-target cleavage.

2022-04-01 | PXD024840 | Pride

Functional analysis of Arabidopsis ARGONAUTE1 using a slicer-defective mutant: Transcript immunoprecipitation

Project description:The Arabidopsis ARGONAUTE (AGO) protein AGO1 associates with microRNA (miRNA) and specific classes of short-interfering RNA (siRNA). AGO1-small RNA complexes recognize target RNA transcripts through base-pairing interactions and inhibit translation of target RNAs through endonucleolytic cleavage (slicing) or non-degradative mechanisms. The PIWI domain of AGO1 contains a metal-coordinating triad [Asp-Asp-His] (DDH) that is required for slicer activity. Here, we compared the activities of wild type (DDH) and slicer active-site defective (DAH) forms of AGO1 by sequencing small RNA and target transcript RNAs that co-immunoprecipitated with hemagglutinin (HA)-tagged AGO1 proteins. We found that the population of miRNA that associated with both AGO1-DDH and AGO1-DAH proteins largely overlapped, suggesting that cleavage activity does not affect miRNA maturation. In contrast, slicer-defective AGO1-miRNA complexes associated with target RNA more effectively than did wild type AGO1-miRNA. These data indicate that slicer-defective AGO proteins can be used as an approach to capture AGO-small RNA-target RNA ternary complexes more efficiently for genome-wide analyses. AGO1-DDH (wild type) AGO1-DAH (slicer mutant) proteins were immunoprecipitated (N-terminal 3xHA) from Arabidopsis (Columbia) flower (stages 1-12) lysate. Immunoprecipitate fractions were treated with nuclease P1 before cleanup to trim free RNA ends, and therefore enrich samples in AGO1 target sites. All samples were treated with Ribominus (Life Technologies) to reduce ribosomal RNA abundance. Transcript fragments from two replicates of AGO1-DDH and AGO1-DAH immunoprecipitates were sequenced. Ribominus-treated total RNA (input controls) was also sequenced for each replicate.

2012-09-28 | E-GEOD-40256 | biostudies-arrayexpress

Profiling of Argonaute (AGO) 2-associated sRNAs after infection of bacterial pathogen Pseudomonas syringae

Project description:Transgenic Arabidopsis plants (AGO2::HA:AGO2) were treated with either mock (10 mM MgCl2) or Pseudomonas syringae pv. tomato (Pst) expressing avrRpt2 (R2) at a concentration of 2 x 107 cfu/ml for 14 hours. sRNAs associated with AGO1 and AGO2 were co-immunoprecipitated using antibodies against either AGO1 (AGO1-IP), or HA (hemagglutinin) (AGO2-IP). As controls, we also gel-purified the 18-28 nt fraction of the total RNAs from an AGO2 mutant (ago2-1). The co-immunoprecipitated or gel-purified RNAs were cloned and sequenced by Illumina deep sequencing.

2011-05-10 | GSE26161 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data