Proteomic analysis of tropomyosin isoforms expressed and purified from Expi293F (human) cells.
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Q Exactive
ORGANISM(S): Homo Sapiens (ncbitaxon:9606)
SUBMITTER: 
Roberto Dominguez
PROVIDER: MSV000087517 | MassIVE | Tue May 25 21:20:00 BST 2021
REPOSITORIES: MassIVE
Similar Datasets
Project description:Abnormal accumulation of aggregated proteins and sustained microglial activation are important contributors of neurodegenerative process in neurological diseases. Recent studies have shown that aggregation-prone proteins, such as a-synuclein, the protein implicated in Parkinson’s disease (PD), are released from neuronal cells and thus present in the extracellular fluid, pointing to the possible paracrine effects of these proteins on microglial immune responses. However, the mechanism underlying the disease-associated microglial activation and the role of neuronal proteins in this process remain unknown. Here, we show that extracellular a-synuclein released from neuronal cells is an endogenous ligand of toll-like receptor 2 (TLR2) and activates microglia, which in turn induces neurodegeneration. Interaction between neuron-released a-synuclein and TLR2 and subsequent activation of the TLR2 signaling were demonstrated comprehensively by using computational modeling of signaling network and by the experimental validation in TLR2-deficient microglia both in vitro and in vivo. In contrast to the neuron-released a-synuclein, recombinant a-synuclein proteins, including monomer, oligomer, fibril, or nitrated forms, were not able to interact or activate TLR2, suggesting that neuronal cells have a mechanism of enriching specific forms of a-synuclein capable of activating TLR2 during the process of releasing this protein. Taken together, the results suggest that both neuron-released extracellular a-synuclein and TLR2 might be novel therapeutic targets for modifying neuroinflammation in PD and related neurodegenerative diseases. We collected culture media from differentiated SH-SY5Y cells overexpressing either human a-synuclein (alpha-SCM) or beta-galactosidase (LZCM) and treat these media to primary rat microglia at the concentration of a-synuclein of 1.1M. Transcriptome analyses with microglial cells treated with either aSCM or LZCM at two different time points, 6 h and 24 h.
2013-02-28 | E-GEOD-26532 | biostudies-arrayexpress
Project description:Aggregation of α-synuclein may trigger the development of synucleinopathies, a progressive neurodegenerative disease such as Parkinson's disease and Dementia with Lewy bodies. We demonstrate RNA initiates α-synuclein phase transition in vitro, however, RNA binding ability and its motif remain unclear. Here, we indicate purified human α-synuclein protein preferentially binds to guanine-rich RNA sequences by RNA Bind-N-Seq using a pool of random 24-mer RNA oligonucleotides in vitro. Importantly, these hit motifs were required consecutive guanines not random, suggesting that RNA G-quadruplexes binds to α-synuclein. We also confirmed that GC content and skew of α-synuclein-enriched RNA sequences were similar to that of BG4 (G-quadruplex antibody)-enriched RNA sequences. Taken together, these data suggest that α-synuclein binds to RNA-formed G-quadruplex.
2023-07-17 | GSE235418 | GEO
Project description:Abnormal accumulation of aggregated proteins and sustained microglial activation are important contributors of neurodegenerative process in neurological diseases. Recent studies have shown that aggregation-prone proteins, such as a-synuclein, the protein implicated in Parkinson’s disease (PD), are released from neuronal cells and thus present in the extracellular fluid, pointing to the possible paracrine effects of these proteins on microglial immune responses. However, the mechanism underlying the disease-associated microglial activation and the role of neuronal proteins in this process remain unknown. Here, we show that extracellular a-synuclein released from neuronal cells is an endogenous ligand of toll-like receptor 2 (TLR2) and activates microglia, which in turn induces neurodegeneration. Interaction between neuron-released a-synuclein and TLR2 and subsequent activation of the TLR2 signaling were demonstrated comprehensively by using computational modeling of signaling network and by the experimental validation in TLR2-deficient microglia both in vitro and in vivo. In contrast to the neuron-released a-synuclein, recombinant a-synuclein proteins, including monomer, oligomer, fibril, or nitrated forms, were not able to interact or activate TLR2, suggesting that neuronal cells have a mechanism of enriching specific forms of a-synuclein capable of activating TLR2 during the process of releasing this protein. Taken together, the results suggest that both neuron-released extracellular a-synuclein and TLR2 might be novel therapeutic targets for modifying neuroinflammation in PD and related neurodegenerative diseases.
2013-02-28 | GSE26532 | GEO
Project description:Abundance and localization of human UBE3A isoforms
| PRJNA512845 | ENA
Project description:Chitin, a polymer of N-acetyl-glucosamne, is a component of the cell walls of many plant fungal pathogens. During the infection process, the released chitin fragments (such as chitooctaose) from fungal cell walls by plant enzymes can trigger plant defense response and gene activation. The current work studies the regulation of Arabidopsis genes by the purified chitin fragment chitooctaose. We used the Affymetric Arabidopsis whole gene arrays to study the gene expression caused by chitin (chitooctaose). Keywords: chitooctaose vs water treatments, with 3 biological replicates
2006-05-03 | GSE4746 | GEO
Project description:Chitin, a polymer of N-acetyl-glucosamne, is a component of the cell walls of many plant fungal pathogens. During the infection process, the released chitin fragments (such as chitooctaose) from fungal cell walls by plant enzymes can trigger plant defense response and gene activation. The current work studies the regulation of Arabidopsis genes by the purified chitin fragment chitooctaose. We used the Affymetric Arabidopsis whole gene arrays to study the gene expression caused by chitin (chitooctaose). Experiment Overall Design: Arabidopsis seedlings grown hydroponically for 14 days were treated with the purified chitin fragment chitooctaose at a final concentration of 1 um for 3 minutes. The controls were similarli treated with an equivalent amount of ddH2O. Three biological replicates were obtained.
2007-10-04 | E-GEOD-4746 | biostudies-arrayexpress
Project description:We report isoCirc, a long-read sequencing strategy coupled with an integrated computational pipeline to characterize full-length circular RNA (circRNA isoforms) using rolling circle amplification (RCA) followed by long-read sequencing. Applying isoCirc to 12 human tissues, we determined full-length structures and examined tissue specificities of circRNA isoforms in human transcriptomes.
2020-09-12 | GSE141693 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
2016-01-11 | GSE69352 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress