Human gut metagenome
Ontology highlight
ABSTRACT:
PROVIDER: PRJDB12857 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| DRR346024_1.fastq.gz | Fastqsanger.gz | |||
| DRR346024_2.fastq.gz | Fastqsanger.gz | |||
| DRR346025_1.fastq.gz | Fastqsanger.gz | |||
| DRR346025_2.fastq.gz | Fastqsanger.gz | |||
| DRR346026_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 82 |
Similar Datasets
Project description:Purpose: Over the past few years, the distinction between left- and right-sided colon cancer has been brought into focus. Right-sided tumor location was associated with an inferior overall survival and progression-free survival. We aimed to perform a detailed analysis of the diversity in exosomes between left- and right-sided colon cancer using quantitative proteomics. Experimental Design: We isolated exosomes from left- and right-sided colon cancer patients and healthy volunteers and treated colorectal cancer cell line with serum-derived exosomes. Then we performed quantitative proteomics analysis of the serum-derived exosomes and cell line treated with exosomes, respectively. Results: The expression profile of the serum exosome proteome in patients with right-sided colon cancer is different from patients with left-sided colon cancer. Serum-derived exosomes of right-sided colon cancer promote metastasis via up-regulation of extracellular matrix-related proteins, especially proteoglycans like SPARC and glycoprotein like LRG1. Exosomal SPARC and LRG1 were closely correlated with progression-free survival. Conclusions: Proteomic analysis identified different exosomal protein profiling between left- and right-sided colon cancer. Serum-derived exosomes of right-sided colon cancer promote metastasis via overexpression of SPARC and LRG1.
2019-11-25 | PXD012304 | Pride
Project description:Purpose: Over the past few years, the distinction between left- and right-sided colon cancer has been brought into focus. Right-sided tumor location was associated with an inferior overall survival and progression-free survival. We aimed to perform a detailed analysis of the diversity in exosomes between left- and right-sided colon cancer using quantitative proteomics. Experimental Design: We isolated exosomes from left- and right-sided colon cancer patients and healthy volunteers and treated colorectal cancer cell line with serum-derived exosomes. Then we performed quantitative proteomics analysis of the serum-derived exosomes and cell line treated with exosomes, respectively. Results: The expression profile of the serum exosome proteome in patients with right-sided colon cancer is different from patients with left-sided colon cancer. Serum-derived exosomes of right-sided colon cancer promote metastasis via up-regulation of extracellular matrix-related proteins, especially proteoglycans like SPARC and glycoprotein like LRG1. Exosomal SPARC and LRG1 were closely correlated with progression-free survival. Conclusions: Proteomic analysis identified different exosomal protein profiling between left- and right-sided colon cancer. Serum-derived exosomes of right-sided colon cancer promote metastasis via overexpression of SPARC and LRG1.
2019-11-25 | PXD012283 | Pride
Project description:Colorectal cancers (CRCs) exhibit differences in incidence, pathogenesis, molecular pathways and outcome depending on the location of the tumor. The transcriptomes of 27,927 single human CRC cells, from three left-sided and three right-sided CRC patients were profiled by scRNA-seq. Right-sided CRC harbors a significant proportion of exhausted CD8 T cells of a highly migratory nature. One cluster of cells from left-sided CRC exhibiting states preceding exhaustion and a high ratio of “pre-exhausted” to exhausted T cells were favorable prognostic markers. Notably, we identified a novel RBP4+ NTS+ subpopulation of cancer cells that exclusively expands in left-sided CRC. Tregs from left-sided CRC showed higher levels of immunotherapy-related genes than those from right-sided CRC, indicating that left-sided CRC may have increased responsiveness to immunotherapy. Antibody-dependent cellular phagocytosis (ADCP) and antibody-dependent cellular cytotoxicity (ADCC) induced by M2-like macrophages were more pronounced in left-sided CRC and correlated with a good prognosis in CRC.
2021-11-15 | GSE188711 | GEO
Project description:In our study, we obtained paired normal left-sided and right-sided colon mucosa tissues by colonoscopy, and 9,642 individual cells were analyzed by single-cell RNA-seq, which aims to explore the differennces of cell component between the left and the right colon.
2024-06-10 | GSE176499 | GEO
Project description:Here, we discovered that the frequency of CD39+γδ Tregs, which positively correlated with poor prognosis, was significantly higher in right-sided colorectal cancer (RSCRC) than in the left-sided CRC (LSCRC). To explore the molecular mechanism leading to the difference of CD39+γδ Tregs derived from RSCRC and LSCRC, we collected fresh tissue samples of RSCRC with high expression of CD39+γδ Tregs and the LSCRC with low expression of CD39+γδ Tregs detected by flow cytometry and identified differential proteins by LC-MS based quantitative proteomic analysis with tandem mass tag (TMT)
2022-02-17 | PXD027323 | Pride
Project description:Resolving the Difference Between Left-sided and Right-sided Colorectal Cancer by Single-cell Sequencing
| PRJNA779978 | ENA
Project description:Alterations in glycosylation are seen in many types of cancer, including colorectal cancer (CRC). CRC is known to display glycosylation alterations. Glycans, the sugar moieties of glycoconjugates, are involved in many important functions relevant to cancer, such as cell signaling and adhesion, and may can be of value as biomarkers. In this study, we have used mass spectrometry to analyze the N-glycan profiles of 35 CRC tissue samples from patients with tumors in the right or left colon and 10 healthy tissue samples from non-CRC patients who underwent operations for other reasons. The tumor samples were divided into groups depending on tumor location (right or left colon) and stage (II or III), while the healthy samples were divided into right or left side of the colon. The levels of neutral and acidic N-glycan compositions and glycan classes were analyzed in a total of ten different groups. Surprisingly, there were no significant differences in glycan levels when all right- and left-sided CRC samples were compared, and few differences (such as in the abundance of the neutral N-glycan H3N5) were seen when the samples were divided according to both location and stage. Multiple significant differences were found in the levels of glycans and glycan classes when stage II and III samples were compared, and these glycans could be of value as candidates for new markers of cancer progression. In order to validate our findings, we analyzed healthy tissue samples from the right and left colon and found no significant differences in the levels of any of the glycans analyzed, confirming that our findings when comparing CRC samples from the right and left colon are not due to normal variations in the levels of glycans between the healthy right and left colon. Additionally, the levels of the acidic glycans H4N3F1P1, H5N4F1P1, and S1H5N4F1 were found to change in a cancer-specific but colon location-nonspecific manner, indicating that CRC affects glycan levels in similar ways, regardless of tumor location.
2020-06-10 | PXD018673 | Pride
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO