In vitro fermentation processed arabinoxylan
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB44740 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR5873150_1.fastq.gz | Fastqsanger.gz | |||
| ERR5873150_2.fastq.gz | Fastqsanger.gz | |||
| ERR5873160_1.fastq.gz | Fastqsanger.gz | |||
| ERR5873160_2.fastq.gz | Fastqsanger.gz | |||
| ERR5873170_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 198 |
Similar Datasets
Project description:Analysis of non-differentiated Caco-2 intestinal epithelial cell line treated with polydextrose fermentation metabolites fermented for 48 hours in 4-stage in vitro colon simulator, in which the conditions mimic the human proximal, ascending, transverse and distal colon in sequence , as well as with medium, 100 mM NaCl and 5 mM butyrate. Polydextrose, a soluble fiber fermented in colon, was fermented with the in vitro colon simulator in three amounts of 0%, 1% and 2%. Results provide insight into the mechanisms underlying colon cancer cells and a comparison of a complex fiber metabolome to 5 mM butyrate and 100 mM NaCl. Furthermore, the results give insight of dosage effect of increasing the concentration of fiber. High level of dietary fiber has been epidemiologically linked to protection against the risk for developing colon cancer. The mechanisms of this protection are not clear. Fermentation of dietary fiber in the colon results in production of for example butyrate that has drawn attention as a chemopreventive agent. Polydextrose, a soluble fiber that is only partially fermented in colon, was fermented in an in vitro colon simulator, in which the conditions mimic the human proximal, ascending, transverse and distal colon in sequence. The subsequent fermentation metabolome were applied on colon cancer cells, and the gene expression changes studied. Polydextrose fermentation down-regulated classes linked with cell cycle, and affected number of metabolically active cells. Further, up-regulated effects on classes linked with apoptosis implicate that polydextrose fermentation plays a role in induction of apoptosis in colon cancer cells. The up-regulated genes involved also key regulators of lipid metabolism, such as PPARg and PGC-1α. These results offer hypotheses for the mechanisms of two health benefits linked with consumption of dietary fiber, reducing risk of development of colon cancer, and dyslipidemia.
2011-04-22 | GSE28792 | GEO
Project description:Analysis of non-differentiated Caco-2 intestinal epithelial cell line treated with polydextrose fermentation metabolites fermented for 48 hours in 4-stage in vitro colon simulator, in which the conditions mimic the human proximal, ascending, transverse and distal colon in sequence , as well as with medium, 100 mM NaCl and 5 mM butyrate. Polydextrose, a soluble fiber fermented in colon, was fermented with the in vitro colon simulator in three amounts of 0%, 1% and 2%. Results provide insight into the mechanisms underlying colon cancer cells and a comparison of a complex fiber metabolome to 5 mM butyrate and 100 mM NaCl. Furthermore, the results give insight of dosage effect of increasing the concentration of fiber. High level of dietary fiber has been epidemiologically linked to protection against the risk for developing colon cancer. The mechanisms of this protection are not clear. Fermentation of dietary fiber in the colon results in production of for example butyrate that has drawn attention as a chemopreventive agent. Polydextrose, a soluble fiber that is only partially fermented in colon, was fermented in an in vitro colon simulator, in which the conditions mimic the human proximal, ascending, transverse and distal colon in sequence. The subsequent fermentation metabolome were applied on colon cancer cells, and the gene expression changes studied. Polydextrose fermentation down-regulated classes linked with cell cycle, and affected number of metabolically active cells. Further, up-regulated effects on classes linked with apoptosis implicate that polydextrose fermentation plays a role in induction of apoptosis in colon cancer cells. The up-regulated genes involved also key regulators of lipid metabolism, such as PPARg and PGC-1α. These results offer hypotheses for the mechanisms of two health benefits linked with consumption of dietary fiber, reducing risk of development of colon cancer, and dyslipidemia. Non-differentiated Caco-2 cells were treated with polydextrose fermentation metabolites from the vessels representing different parts of the colon, or with 100 mM NaCl or with 5 mM butyrate for 24 hours. For polydextrose fermentation three concentrations of polydextrose were used: 0%, 1% and 2% for a simulation that lasted for 48 hours. Polydextrose fermentation samples from total of 12 vessels, as well as from medium sample, 5 mM butyrate and 100 mM NaCl were analysed as single replica.
2011-04-22 | E-GEOD-28792 | biostudies-arrayexpress
Project description:In vitro rumen fermentation Raw sequence reads
| PRJNA560091 | ENA
Project description:In vitro batch fermentation by-products
| PRJEB38263 | ENA
Project description:In vitro fermentation of gut bacteria with polyphenols adsorbed to apple cell walls.
| PRJEB33502 | ENA
Project description:In vitro fermentation of Astragalus polysaccharide
| PRJNA650589 | ENA
Project description:High-throughput sequencing of in vitro fecal fermentation samples
| PRJNA821446 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Wheat-based food form has a greater effect than amylose content on fermentation outcomes and microbial community shifts in an in vitro fermentation model
| PRJEB41407 | ENA