Oryza sativa
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA107871 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682.
2009-06-08 | GSE16248 | GEO
Project description:In order to identify new miRNAs, NAT-siRNAs and possibly abiotic-stress regulated small RNAs in rice, three small RNA libraries were constructed from control rice seedlings and seedlings exposed to drought or salt stress, and then subjected to pyrosequencing.
2008-12-08 | GSE12317 | GEO
Project description:Rice is one of the most important global food crops, and is also a model organism for cereal research 31 . Complete genome sequencing of rice, together with advances in transcriptomics and proteomics, has had a dramatic impact on plant growth and 5 breeding programs 32 . Genomic analysis of DNA methylation in rice has revealed methylation patterns associated with gene bodies and promoters, and the occurrence of high levels of DNA methylation in the centromeric domain 33 . A genome-wide investigation of acetylation in rice revealed that H3K9ac and H3K27ac are mainly enriched at transcription start sites associated with active transcription 34 . Furthermore, global proteome analysis has shown that phosphorylation and succinylation are involved in diverse cellular and metabolic processes 35, 36 . However, despite these considerable advances in our knowledge, additional large-scale analysis of the lysine acetylome in rice is expected to identify many more Kac sites and acetylated proteins in this improtant crop plant. In this study, affinity enrichment and high-resolution LC-MS/MS were used for large-scale analysis of the lysine acetylome in rice variety Nipponbare. In total, 1353 lysine acetylation sites were detected in 866 protein groups in rice seedlings. Proteomic analysis showed that Kac occurs in proteins involved in diverse biological processes with varied cellular functions and subcellular localization.
2017-11-13 | PXD004870 | Pride
Project description:Genome-wide profiling of small RNAs in rice under abiotic stresses
| PRJNA136743 | ENA
Project description:Identification of all expressed transcripts in a sequenced complex genome is technically challenging, but essential for systems biology and genome analysis. We used the transcriptional profiling technology called ‘massively parallel signature sequencing’ (MPSS) to develop a comprehensive expression atlas of rice (Oryza sativa cv Nipponbare). A total of 46,971,553 mRNA transcripts from 22 libraries, and 2,953,855 small RNAs from three libraries were sequenced. The data demonstrated widespread transcription throughout the genome, including expression for up to 25,500 annotated genes and antisense expression for nearly 9,000 annotated genes. An additional set of ~15,000 mRNA signatures mapped to unannotated genomic regions. The majority of the small RNA data represented lower abundance small-interfering RNAs (siRNAs) that match repetitive sequences, intergenic regions, and genes. Among these, numerous clusters of highly-regulated small RNAs were readily observed. We developed a genome browser (http://mpss.udel.edu/rice) for public access to the transcriptional profiling data for this important crop plant. Keywords: MPSS, mRNA, small RNA, transcriptome, rice
2007-02-23 | GSE7107 | GEO
Project description:In order to identify new miRNAs, NAT-siRNAs and possibly abiotic-stress regulated small RNAs in rice, three small RNA libraries were constructed from control rice seedlings and seedlings exposed to drought or salt stress, and then subjected to pyrosequencing. Totally three sets of small RNAs, which were obtained under normal condition as well as salt and drought stress conditions
2008-12-08 | E-GEOD-12317 | biostudies-arrayexpress
Project description:Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus
| PRJNA138141 | ENA
Project description:LongSAGE library in this series are from 'Whole Genome Analysis of Pathogen-Host Recognition and Subsequent Responses in the Rice Blast Patho-System' project. This work is supported by NSF-PGRP #0115642. Keywords: other
2004-11-08 | GSE1924 | GEO
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress