Oryza sativa
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA524942 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR8675960_1.fastq.gz | Fastqsanger.gz | |||
| SRR8675960_2.fastq.gz | Fastqsanger.gz | |||
| SRR8675970_1.fastq.gz | Fastqsanger.gz | |||
| SRR8675970_2.fastq.gz | Fastqsanger.gz | |||
| SRR8675961_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 40 |
Similar Datasets
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682.
2009-06-08 | GSE16248 | GEO
Project description:Studies have shown that Rice Salt Sensitive 1 (RSS1) is involved in stress response in rice plants. Primers were developed for amplification via Polymerase Chain Reaction (PCR) of a region that contained a simple sequence repeat (SSR) in RSS1. PCR was performed on 6 different varieties of Oryza sativa. PCR product was sequenced on an ABI 3730 capillary sequence machine. Sequence data was aligned to observe differences in SSR length between each rice variety.
2017-12-31 | E-MTAB-5583 | biostudies-arrayexpress
Project description:Phosphate starvation/sufficient rice seedling, root or shoot Pi-starvation or Pi-sufficient stresses responsible rice genes, including previously unannotated genes were identified by Illumina mRNA-seq technology. 53 million reads from Pi-starvation or Pi-sufficient root or shoot tissues were uniquely mapped to the rice genome, and these included 40574 RAP3 transcripts in root and 39748 RAP3 transcripts in shoot. We compared our mRNA-seq expression data with that from Rice 44K oligomicroarray, and about 95.5% (root) and 95.4% (shoot) transcripts supported by the array were confirmed expression both by the array and by mRNA-seq, Moreover, 11888 (root) and 11098 (shoot) RAP genes which were not supported by array, were evidenced expression with mRNA-seq. Furthermore, we discovered 8590 (root) and 8193 (shoot) previously unannotated transcripts upon Pi-starvation and/or Pi-sufficient.
2012-01-06 | E-MTAB-4302 | biostudies-arrayexpress
Project description:Studies have shown that Respiratory Burst Oxidase Homolog B (RBOHB) are involved in stress response in rice plants. Primers were developed for amplification via Polymerase Chain Reaction (PCR) of a region that contained a simple sequence repeat (SSR) in RBOHB. PCR was performed on 6 different varieties of Oryza sativa. PCR product was sequenced on an ABI 3730 capillary sequence machine. Sequence data was aligned to observe differences in SSR length between each rice variety.
2017-12-31 | E-MTAB-5560 | biostudies-arrayexpress
Project description:We aimed to identify differential expression of microRNAs between superior and inferior spikelets by using a deep sequencing approach developed by Solexa (Illumina). Two small RNA libraries were constructed from superior and inferior spikelets at 18 days after fertilization, and more than nine million small RNA sequence reads were generated for each library. Totals of 351 and 312 known miRNAs were obtained from the superior and inferior spikelets, respectively. Analysis of the expression profiles of these miRNAs showed that 189 miRNAs were differentially expressed between superior spikelets and inferior spikelets. In addition, 43 novel miRNAs were identified mostly by the accumulations of miRNA*s were also expressed differentially. Further analysis shows that these miRNAs may individually participate in regulating hormone metabolism, carbohydrate metabolic pathways, and cell division during rice grain development. These results indicate that slow grain filling and low grain weight of rice inferior spikelets probably relation to the expression and function differences between superior and inferior spikelet miRNAs.
2011-03-19 | GSE28028 | GEO
Project description:A biological phenomenon in which hybrids exhibit superior phenotypes from its parental inbred lines known as heterosis, has been widely exploited in plant breeding and extensively used in crop improvement. Hybrid rice has immense potential to increase yield over other rice varieties and hence is crucial in meeting increasing demand of rice globally. Moreover, the molecular basis of heterosis is still not fully understood and hence it becomes imperative to unravel its genetic and molecular basis. In this context, RNA sequencing technology (RNA-Seq) was employed to sequence transcriptomes of two rice hybrids, Ajay and Rajalaxmi, their parental lines, CRMS31A (sterile line, based on WA-CMS) and CRMS32A (sterile line based on Kalinga-CMS) respectively along with the common restorer line of both hybrids, IR-42266-29-3R at two critical rice developmental stages viz., panicle initiation (PI) and grain filling (GF). Identification of differentially expressed genes (DEGs) at PI and GF stages will further pave the way for understanding heterosis. In addition, such kind of study would help in better understanding of heterosis mechanism and genes up-regulated and down-regulated during the critical stages of rice development for higher yield.
2015-08-02 | E-MTAB-4291 | biostudies-arrayexpress
Project description:5 leaves old rice plantlets were infected with Magnaporthe grisea spores and zero, two hours and twenty four houres after infection samples were collected
2014-01-31 | GSE50454 | GEO
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:DNA methylation of rice heterosis Raw sequence reads
| PRJNA436599 | ENA