Landscape of ribosome-engaged alternative transcript isoforms across neuronal cell classes
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA552065 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The goal of this project was to assess how alternative splicing programs are arrayed across neuronal cells types. We systematically mapped ribosome-associated transcript isoforms in genetically-defined neuron types of the mouse forebrain. The endogenous ribosomal protein Rpl22 was conditionally HA-tagged in glutamatergic neurons (using CamK2-cre for most neocortical pyramidal cells and Scnn1a-cre for spiny stellate and star pyramid layer 4 cells), and GABAergic interneurons [with somatostatin-cre (SST), parvalbumin-cre (PV) and vasointestinal peptide-cre (VIP)]. Within the hippocampus, we further targeted Cornu ammonis 1 (CA1) neurons (CamK2-cre), CA3 neurons (Grik4-cre), and SST-positive interneurons (SST-cre). Four replicates were deep sequenced (~100 million reads) using an Illumina platform. We find that neuronal transcript isoform profiles reliably distinguish even closely-related classes of pyramidal cells and inhibitory interneurons in the mouse hippocampus and neocortex, positing transcript diversification by alternative splicing as a central mechanism for the functional specification of neuronal cell types and circuits.
2019-07-01 | GSE133291 | GEO
Project description:Nervous system function relies on complex assemblies of distinct neuronal cell types that have unique anatomical and functional properties instructed by molecular programs. Alternative splicing is a key mechanism for the expansion of molecular repertoires, and protein splice isoforms shape neuronal cell surface recognition and function. However, the logic of how alternative splicing programs are arrayed across neuronal cells types is poorly understood. We systematically mapped ribosome-associated transcript isoforms in genetically defined neuron types of the mouse forebrain. Our dataset provides an extensive resource of transcript diversity across major neuron classes. We find that neuronal transcript isoform profiles reliably distinguish even closely related classes of pyramidal cells and inhibitory interneurons in the mouse hippocampus and neocortex. These highly specific alternative splicing programs selectively control synaptic proteins and intrinsic neuronal properties. Thus, transcript diversification via alternative splicing is a central mechanism for the functional specification of neuronal cell types and circuits.
| S-EPMC6763336 | biostudies-literature
Project description:High-throughput RNA sequencing (RNA-seq) has revealed an enormous complexity of alternative splicing (AS) across diverse cell and tissue types. However, it is currently unknown to what extent repertoires of splice-variant transcripts are translated into protein products. Here, we surveyed AS events engaged by the ribosome. Notably, at least 75% of human exon-skipping events detected in transcripts with medium-to-high abundance in RNA-seq data were also detected in ribosome profiling data. Furthermore, relatively small subsets of functionally related splice variants are engaged by ribosomes at levels that do not reflect their absolute abundance, thus indicating a role for AS in modulating translational output. This mode of regulation is associated with control of the mammalian cell cycle. Our results thus suggest that a major fraction of splice variants is translated and that specific cellular functions including cell-cycle control are subject to AS-dependent modulation of translation output.
| S-EPMC5295628 | biostudies-literature
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
2016-01-11 | GSE69352 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:Translation canonically begins at a single AUG and terminates at the stop codon, generating one protein species per transcript. However, some transcripts may use alternative initiation sites or sustain translation past their stop codon, generating multiple protein isoforms. Through other mechanisms such as alternative splicing, both neurons and glia exhibit remarkable transcriptional diversity, and these other forms of post-transcriptional regulation are impacted by neural activity and disease. Here, using ribosome footprinting, we demonstrate that alternative translation is likewise abundant in the central nervous system and modulated by stimulation and disease. First, in neuron/glia mixed cultures we identify hundreds of transcripts with alternative initiation sites and confirm the protein isoforms corresponding to a subset of these sites by mass spectrometry. Many of them modulate their alternative initiation in response to KCl stimulation, indicating activity-dependent regulation of this phenomenon. Next, we detect several transcripts undergoing stop codon readthrough thus generating novel C-terminally-extended protein isoforms in vitro. Further, by coupling Translating Ribosome Affinity Purification to ribosome footprinting to enable cell-type specific analysis in vivo, we find that several of both neuronal and astrocytic transcripts undergo readthrough in the mouse brain. Functional analyses of one of these transcripts, Aqp4, reveals readthrough confers perivascular localization, indicating readthrough can be a conserved mechanism to modulate protein function. Finally, we show that AQP4 readthrough is disrupted in multiple gliotic disease models. Our study demonstrates the extensive and regulated use of alternative translational events in the brain and indicates that some of these events alter key protein properties. [NOTE: this GEO series only contains in vivo data]
2019-01-14 | GSE115483 | GEO
Project description:Purpose: Alternative polyadenylation (APA) can result in the generation of transcripts that terminate at different locations within the gene, which can result in different 3' UTRs. 3´ UTRs are known to contain RNA stabilizing and destabilizing motifs that provide a platform for binding of RNA binding proteins. Changes in 3´ UTRs for the different APA-generated isoforms of a gene could allow for inclusion or exclusion of these RNA stability elements. The goal of this study is determine the stability (half-lives based on transcript decay) of APA isoforms in proliferating and quiescent cells. Methods: The proliferating and quiescent (7-day contact inhibited) cells were treated with actinomycin D to stop transcription and the cells were harvested at different time points (0. 2, 4, 8 hours) for RNA isolation and global sequencing of 3´ ends. The adaptors and polyA sequenced were trimmed from each read. The reads were aligned to the human genome (hg19) using TopHat (v2.0.14). The aligned read files were used to determine the counts of APA isoforms of each gene using the code provided by Gruber et al. (PMID: 27382025). The counts of the APA isoforms were fit to an exponential decay model to obtain half-lives. The entire workflow was performed for two biological replicates: 12-1 and 12-3 strains of human dermal fibroblasts. Results: In two different fibroblast strains (12-1 and 12-3), we found that isoforms terminating at distal polyadenylation sites were more stable than isoforms terminating at proximal polyadenylation sites in quiescent, but not proliferating, fibroblasts. Conclusions: The transition from shorter to longer isoforms in quiescent cells is associated with stabilization of the transcripts.
2018-08-28 | GSE117121 | GEO
Project description:The aim of this study was to obtain a landscape of alternative splicing (AS) in human hepatocellular carcinoma (HCC). We applied hybrid sequencing by integrating Pacbio long-read and Illumina short-read RNA sequencing data from 8 patient-derived HCC cell lines, and used an immortalized hepatocyte cell line as reference. This study revealed features of annotated and novel splice variants in HCC cells, including transcript length, AS type and protein changes. We also identified novel isoforms and tumor specific isoforms, which may represent potential biomarkers and targets for therapeutic development.
| EGAS00001002697 | EGA
Project description:Protein ubiquitylation is a dynamic post-translational modification that can be reversed by deubiquitylating enzymes (DUBs). It is unclear how the small number of ~100 DUBs present in mammalian cells regulates the thousands of different ubiquitylation events. Here we analysed annotated transcripts of human DUBs and find ~300 ribosome-associated transcripts annotated as protein coding, which thus increase the total number of DUBs. Using USP35, a poorly studied DUB, as a case study we provide evidence that alternative isoforms contribute to the functional expansion of DUBs. We show the existence of two different USP35 isoforms that localise to different intracellular compartments and have distinct functions. Our results reveal that isoform 1 is an anti-apoptotic factor that inhibits staurosporine- and TNF-related apoptosis inducing ligand (TRAIL)-induced apoptosis. In contrast, USP35 isoform 2 is an integral membrane protein of the endoplasmic reticulum (ER) present also at lipid droplets. Manipulations of isoform 2 levels cause rapid ER stress likely through deregulation of lipid homeostasis and lead to cell death. Our work highlights how alternative isoforms provide functional expansion of DUBs and sets directions for future research.
2018-04-27 | PXD009286 | Pride
Project description:Alternative first exon isoforms are frequently observed among transcriptomes derived from different developmental stages of eukaryotes. Stage-specific alternative first exon (SAFE) transcripts are usually involved in the regulation of cell development in spatiotemporal manners. The transcriptome analysis for RNA-seq data make it possible to identify specifically used first exons in mouse embryonic stem cells (mESCs) compared to somatic cells, just like tail tip fibroblasts (TTFs). In this study, we identify 128 genes producing SAFE isoforms in mESCs.
2015-10-01 | GSE56529 | GEO