Ontology highlight
ABSTRACT:
PROVIDER: PRJNA576274 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:High-throughput 16S rRNA amplicon pyrosequencing of contaminated aquifer sediment
| PRJNA134929 | ENA
Project description:Understanding microbial community diversity is thought to be crucial for improving process functioning and stabilities of wastewater treatment systems. However, current studies largely focus on taxonomic groups based on 16S rRNA, which are not necessarily linked to functioning, or a few selected functional genes. Here we launched a study to profile the overall functional genes of microbial communities in three full-scale wastewater treatment systems. Triplicate activated sludge samples from each system were analyzed using a high-throughput metagenomics tool named GeoChip 4.2, resulting in the detection of 38,507 to 40,647 functional genes. A high similarity of 75.5% to 79.7% shared genes was noted among the nine samples. Moreover, correlation analyses showed that the abundances of a wide array of functional genes were associated with system performances. For example, the abundances of overall nitrogen cycling genes had a strong correlation to total nitrogen (TN) removal rates (r = 0.7647, P < 0.01). The abundances of overall carbon cycling genes were moderately correlated with COD removal rates (r = 0.6515, P < 0.01). Lastly, we found that influent chemical oxygen demand (COD inf) and total phosphorus concentrations (TP inf), and dissolved oxygen (DO) concentrations were key environmental factors shaping the overall functional genes. Together, the results revealed vast functional gene diversity and some links between the functional gene compositions and microbe-mediated processes.
2014-12-31 | GSE53744 | GEO
Project description:Hematopietic system high resolution transcriptome
| PRJNA107923 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO