An integrated transcriptomics and metabolomics study of the immune response of newly hatched chicks to the CpG-ODN stimulation
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA577887 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:This study aims at identifying a dual transcriptomics and metabolomics blood signature following administration of CpG-ODN (cytosine-phosphate-guanine oligodeoxynucleotides), a reference immune-stimulatory molecule. A clinical study was conducted with chicks and transcriptomics and metabolomics analyses were performed on whole-blood and plasma samples respectively. Statistical analyses resulting in lists of differentially expressed genes and metabolites with different abundance were identified in chicks treated with CpG-ODN. The results showed that CpG-ODN activates the innate immune systems within hours following administration and its effect lasts over time, as metabolomic and transcriptomic profiles are still varying at 6 days after administration.
2019-10-17 | GSE138956 | GEO
Project description:To identify markers associated with inherent cellular sex-identity, we analysed macrophages from newly-hatched chicks. We found that male and female macrophages respond differently to stimulation by bacterial lipopolysaccharide and that female macrophages constitutively express higher levels of interferon target genes than male macrophages.
2014-07-31 | GSE59920 | GEO
Project description:To identify markers associated with inherent cellular sex-identity, we analysed macrophages from newly-hatched chicks. We found that male and female macrophages respond differently to stimulation by bacterial lipopolysaccharide and that female macrophages constitutively express higher levels of interferon target genes than male macrophages. Macrophages were collected from leg-bones of chickens between 1 and 3 days after hatch. Three pools of macrophage cells were made for male and female cultures. Cells were cultured in either standard medium or in medium containing lipopolysaccharide (LPS) to activate the macrophages. Macrophages were harvested and RNA collected for microarray analysis.
2014-07-31 | E-GEOD-59920 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:CD14+ purified bovine monoctye stimulation with CpG ODN 2007 vs. GpC ODN 2007, CpG 2007 vs. Control, GpC 2007 vs. Control and Media vs Control (Control is unstimluated CD14+ purified bovine monocytes at time zero). Before stimulation, the CD14+ purified bovine monocytes were rested for 20 h. Then the cells were stimulated for 4hrs.
2005-01-01 | E-FPMI-2 | biostudies-arrayexpress
Project description:CpG-ODN is a potent immuno-stimulatory molecule. In order to exclude a direct effect of murine CpG-ODN on IGROV1 human ovarian cancer cell line a gene expression experiment was performed.
2011-04-01 | GSE23442 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:The first period post-hatch with all its stimuli could potentially be stressful for the chicks, and by that affect the welfare of the chicken as they mature. By measuring changes in the transcriptome, along with behavioural phenotypes and hormonal levels, the aim is to investigate short and long term effects on the chicken. One batch of chicken were hatched in a production environment, and underwent the same treatment all newly hatched production animals do (sorting, sexing and transportation). Eggs of the same age were simultaneously incubated and hatched in a control environment in a lab. From the end of day one after hatch, both groups were reared under the same conditions in the lab.
2017-02-28 | E-MTAB-4735 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the following subset Series: GSE23440: Gene expression profiling of IGROV1 cells after in vitro treatment with ascitic fluid from human ovarian cancer bearing mice GSE23441: IGROV1 gene expression analysis after in vivo locoregional treatment with CpG-ODN GSE23442: Gene expression profile of IGROV1 cells after in vitro treatment with CpG-ODN Refer to individual Series
2011-04-01 | E-GEOD-23491 | biostudies-arrayexpress