Ontology highlight
ABSTRACT:
PROVIDER: PRJNA612419 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:Targeted long-read nanopore sequencing.
Abstract: Fusion genes are hallmarks of various cancer types and important determinants for diagnosis, prognosis and treatment. Fusion gene partner choice and breakpoint-position promiscuity restricts diagnostic detection, even for known and recurrent configurations. To accurately and impartially identify fusions, we developed FUDGE: FUsion Detection from Gene Enrichment. FUDGE couples target-selected and strand-specific CRISPR/Cas9 activity for fusion gene driver enrichment - without prior knowledge of fusion partner or breakpoint-location – to long-read Nanopore sequencing with the bioinformatics pipeline NanoFG. FUDGE has flexible target-loci choices and enables multiplexed enrichment for simultaneous analysis of several genes in multiple samples in one sequencing run. We observe on-average 665 fold breakpoint-site enrichment and identify nucleotide resolution fusion breakpoints - within two days. The assay identifies cancer cell line and tumor sample fusions irrespective of partner gene or breakpoint-position. FUDGE is a rapid and versatile fusion detection assay, providing unparalleled opportunity for diagnostic pan-cancer fusion detection.
| EGAD00001006111 | EGA
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:To uncover, in an unbiased fashion, which elements of the 18 kb translocated region control EVI1 transcription, we devised a CRISPR/Cas9-based enhancer scanning approach. We considered all possible sgRNA target sites containing a canonical Cas9 PAM site (NGG) on both strands of the minimal 18 kb translocated region. Deep-sequencing libraries were generated by PCR amplification of sgRNA guide strands using primers that tag the product with standard Illumina adapters and a 4 bp sample barcode in a 2 step-PCR protocol.
2021-07-26 | E-MTAB-9948 | biostudies-arrayexpress
Project description:The mammalian genome has an abundance of transposable elements, but understanding their contribution to complex biological systems is poorly understood. Here, we report the CRISPR/Cas9 deletion of a retrotransposon (Lx9c11) in mice and its effect on the immune response to virus infection. The regulatory role for Lx9c11 was assessed by RNA-seq analysis of knockout and wild-type mice, treated with CVB4 virus. Long read nanopore RNA-seq of transcripts enriched from Slfn1 locus (mm10, chr11:83109157-83116657).
2022-04-27 | E-MTAB-8436 | biostudies-arrayexpress
Project description:This dataset contains Xdrop followed by oxford nanopore long read sequencing performed in target tRNA gene deletion clones in HAP1 (t72) and HepG2 (t15). By applying de novo assembly based approach to Xdrop-LRS data, we identified Cas9-induced on-target genomic alteration.
2022-09-16 | E-MTAB-10652 | biostudies-arrayexpress
Project description:Tuberous sclerosis complex (TSC) is a relatively common autosomal dominant disorder characterized by multiple dysplastic organ lesions and neuropsychiatric symptoms, caused by loss-of-function mutation of either TSC1 or TSC2. Target-capture full-length double-stranded cDNA sequencing using long-read sequencer Nanopore (Nanopore Long-read Target Sequencing) revealed that the various kinds of the TSC1 and TSC2 full-length transcripts and the novel intron retention transcripts of TSC2 in TSC patient. Our results indicate that the Nanopore Long-read Target Sequencing is useful for the detection of mutations and confers information on the full-length alternative splicing transcripts for the genetic diagnosis.
2023-09-04 | GSE241410 | GEO
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress
Project description:This dataset contains Xdrop followed by oxford nanopore long read sequencing performed in target tRNA gene deletion (t8) and intergenic region deletion (i50) clones in HepG2 . By applying de novo assembly based approach to Xdrop-LRS data, we identified Cas9-induced on-target genomic alteration.
2022-09-16 | E-MTAB-11327 | biostudies-arrayexpress
Project description:As transposon sequencing (TnSeq) assays have become prolific in the microbiology field, it is of interest to scrutinize their potential drawbacks. TnSeq results are determined by counting transposon insertions following the PCR-based enrichment and subsequent deep sequencing of transposon insertions. Here we explore the possibility that PCR amplification of transposon insertions in a TnSeq library skews the results by introducing bias into the detection and/or enumeration of insertions. We compared the detection and frequency of mapped insertions when altering the number of PCR cycles in the enrichment step. In addition, we devised and validated a novel, PCR-free TnSeq method where the insertions are enriched via CRISPR/Cas9-targeted transposon cleavage and subsequent Oxford Nanopore sequencing. These PCR-based and PCR-free experiments demonstrate that, overall, PCR amplification does not significantly bias the results of the TnSeq assay insofar as insertions in the majority of genes represented in our library were similarly detected regardless of PCR cycle number and whether or not PCR amplification was employed. However, the detection of a small subset of genes which had been previously described as essential is indeed sensitive to the number of PCR cycles. We conclude that PCR-based enrichment of transposon insertions in a TnSeq assay is reliable but researchers interested in profiling essential genes should carefully weigh the number of amplification cycles employed in their library preparation protocols. In addition, we present a PCR-free TnSeq alternative that is comparable to traditional PCR-based methods although the latter remain superior owing to their accessibility and high sequencing depth.
2020-12-21 | GSE162988 | GEO