Ontology highlight
ABSTRACT:
PROVIDER: PRJNA627262 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:16S rRNA gene V4 region of samples from karst caves in southwest China Raw sequence reads
| PRJNA497480 | ENA
Project description:Soil bacteria sequence in the karst region of Southwest China Genome sequencing and assembly
| PRJNA727928 | ENA
Project description:Understanding the environmental factors that shape microbial communities is crucial, especially in extreme environments, like Antarctica. Two main forces were reported to influence Antarctic soil microbes: birds and plants. Both birds and plants are currently undergoing unprecedented changes in their distribution and abundance due to global warming. However, we need to clearly understand the relationship between plants, birds and soil microorganisms. We therefore collected rhizosphere and bulk soils from six different sampling sites subjected to different levels of bird influence and colonized by Colobanthus quitensis and Deschampsia antarctica in the Admiralty Bay, King George Island, Maritime Antarctic. Microarray and qPCR assays targeting 16S rRNA genes of specific taxa were used to assess microbial community structure, composition and abundance and analyzed with a range of soil physico-chemical parameters. The results indicated significant rhizosphere effects in four out of the six sites, including areas with different levels of bird influence. Acidobacteria were significantly more abundant in soils with little bird influence (low nitrogen) and in bulk soil. In contrast, Actinobacteria were significantly more abundant in the rhizosphere of both plant species. At two of the sampling sites under strong bird influence (penguin colonies), Firmicutes were significantly more abundant in D. antarctica rhizosphere but not in C. quitensis rhizosphere. The Firmicutes were also positively and significantly correlated to the nitrogen concentrations in the soil. We conclude that the microbial communities in Antarctic soils are driven both by bird and plants, and that the effect is taxa-specific.
2012-06-01 | GSE33847 | GEO
Project description:Comparison of probe-target dissociations of probe Eub338 and Gam42a with native RNA of P. putida, in vitro transcribed 16s rRNA of P. putida, in vitro transcribed 16S rRNA of a 2,4,6-trinitrotoluene contaminated soil and an uncontaminated soil sample. Functional ANOVA revealed no significant differences in the dissociation curves of probe Eub338 when hybridised to the different samples. On the opposite, the dissociation curve of probe Gam42a with native RNA of P. putida was significantly different than the dissociation curves obtained with in vitro transcribed 16S rRNA samples. Keywords: Microbial diversity, thermal dissociation analysis, CodeLink microarray
2005-11-05 | GSE3525 | GEO
Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction A ten chip study using PCR amplicons from cloned 16S rRNA genes and from diverse soil 16S rRNAs, with PCR primers specific to the Division Acidobacteria. Each chip measures the signal from 42,194 probes (in triplicate) targeting Acidobacteria division, subdivision, and subclades as well as other bacterial phyla. All samples except one (GSM464591) include 2.5 M betaine in the hybridization buffer. Pair files lost due to a computer crash.
2010-06-24 | E-GEOD-18711 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction
2010-01-01 | GSE18711 | GEO
Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
2019-02-08 | GSE98944 | GEO
Project description:Root exudates are composed of primary and secondary metabolites known to modulate the rhizosphere microbiota. Glucosinolates are defense compounds present in the Brassicaceae family capable of deterring pathogens, herbivores and biotic stressors in the phyllosphere. In addition, traces of glucosinolates and their hydrolyzed byproducts have been found in the soil, suggesting that these secondary metabolites could play a role in the modulation and establishment of the rhizosphere microbial community associated with this family. We used Arabidopsis thaliana mutant lines with disruptions in the indole glucosinolate pathway, liquid chromatography-tandem mass spectrometry (LC-MS/MS) and 16S rRNA amplicon sequencing to evaluate how disrupting this pathway affects the root exudate profile of Arabidopsis thaliana, and in turn, impacts the rhizosphere microbial community. Chemical analysis of the root exudates from the wild type Columbia (Col-0), a mutant plant line overexpressing the MYB transcription factor ATR1 (atr1D) which increases glucosinolate production, and the loss-of-function cyp79B2cyp79B3 double mutant line with low levels of glucosinolates confirmed that alterations to the indole glucosinolate biosynthetic pathway shifts the root exudate profile of the plant. We observed changes in the relative abundance of exuded metabolites. Moreover, 16S rRNA amplicon sequencing results provided evidence that the rhizobacterial communities associated with the plant lines used were directly impacted in diversity and community composition. This work provides further information on the involvement of secondary metabolites and their role in modulating the rhizobacterial community. Root metabolites dictate the presence of different bacterial species, including plant growth-promoting rhizobacteria. Our results suggest that alterations in the indole glucosinolate pathway cause disruptions beyond the endogenous levels of the plant, significantly changing the abundance and presence of different metabolites in the root exudates of the plants as well as the microbial rhizosphere community.
2023-05-31 | MSV000092068 | MassIVE