Ontology highlight
ABSTRACT:
PROVIDER: PRJNA681106 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR13171639_1.fastq.gz | Fastqsanger.gz | |||
| SRR13171639_2.fastq.gz | Fastqsanger.gz | |||
| SRR13171640_1.fastq.gz | Fastqsanger.gz | |||
| SRR13171640_2.fastq.gz | Fastqsanger.gz | |||
| SRR13171641_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 18 |
Similar Datasets
Project description:Prey selection of the bat Myotis daubentonii
| PRJNA300340 | ENA
Project description:Mandarin fish Siniperca chuatsi (Basilewsky) (Percichthyidae), as a demersal piscivore, has very specialized feeding habits, for as soon as they start feeding the fry of this fish feed solely on fry of other fish species. In rearing conditions, mandarin fish has been found to accept live prey fish only, and refuse dead prey fish or artificial diets, very little is currently known about the molecular mechanisms of multiple genes which cover different pathways influencing the specialized food habit, such as live prey. We performed transcriptome comparisons between dead prey fish feeders and nonfeeders in mandarin fish. The determination mechanisms of specialized food habit (live prey fish) in mandarin fish could provide some instructions for research of food habit in animals, including mammals.
2013-10-21 | E-MTAB-1365 | biostudies-arrayexpress
Project description:Human brown and white adipocytes (hBAT and hWAT) display markedly distinct m6A landscapes; besides, in insulin-resistant humans and mice, methyltransferase like 14 (METTL14) expression differs significantly between BAT and WAT in the context of its correlation with insulin sensitivity. We therefore employed independent BAT- and WAT-specific METTL14 knockout models to unveil the cell-type specificity of m6A mRNA methylation. Mettl14 knockout via Ucp1-cre or Adipoq-cre drivers in BAT and WAT, respectively, yields divergent metabolic outcomes in mouse.
2024-11-08 | GSE250137 | GEO
Project description:Variation among individuals is a prerequisite of evolution by natural selection. As such, identifying the origins of variation is a fundamental goal of biology. We investigated the link between gene interactions and variation in gene expression among individuals and species, using the mammalian limb as a model system. We first built interaction networks for key genes regulating early (outgrowth; E9.5-11) and late (expansion and elongation; E11-13) limb development in mouse. This resulted in an Early (ESN) and Late (LSN) Stage Network. Computational perturbations of these networks suggest that the ESN is more robust. We then quantified levels of the same key genes among mouse individuals, and found that they vary less at earlier limb stages and that variation in gene expression is heritable. Finally, we quantified variation in gene expression levels among four mammals with divergent limbs (bat, opossum, mouse and pig), and found that levels vary less among species at earlier limb stages. We also found that variation in gene expression levels among individuals and species are correlated for earlier and later limb development. In conclusion, results are consistent with the robustness of the ESN buffering among-individual variation in gene expression levels early in mammalian limb development, and constraining the evolution of early limb development among mammalian species. Bat, mouse, opossum, and pig mRNA profiles at early and late developmental stages on each species fore and hind-limbs . Various replicates of each library were generated by single-end sequencing using Illumina HiSeq 2500. Please note that the De novo transcriptome assembly for bat (Trinity.fasta) was generated from pooled RNA-seq data of fore and hind-limbs at various embryonic developmental stages; Beginning stage (Wanek stage 2: 3 FL and 3 HL samples), early-stage (Wanek stage 3/4: 2 FL and 2 HL samples), and late_stage (Wanke stage 6: 2 FL and 2 HL samples).
2015-08-24 | E-GEOD-71390 | biostudies-arrayexpress
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress
Project description:In Arabidopsis thaliana a high rate of spontaneous epigenetic variation can occur in the DNA methylome in the absence of genetic variation and selection. It has been of great interest, whether natural epigenetic variation is subject to selection and contributes to fitness and adaptation in selective environments. We compared the variation in selected phenotypic traits, genome-wide cytosine DNA methylation and gene expression in two Arabidopsis recombinant inbred lines, which had undergone five generations of selection in experimental landscapes relative to their genetically identical ancestors. Selected populations exerted significant differences in flowering time and the number of branches and fruits, differences that were maintained over two to three generations in the absence of selection. We identified 4,629 and 5,158 differentially methylated cytosines which were overrepresented in genes that regulate flowering time, epigenetic processes, development and morphogenesis. Differentially methylated genes were enriched in differentially expressed genes. Thus, epigenetic variation is subject to selection and may play an important role in the adaptive response of populations in rapidly changing natural environments. Genomic DNA was extracted from whole-plant above-ground tissue of individual 25-day-old plants with the Qiagen DNeasy kit (Qiagen). DNA from two randomly chosen CVL39 individuals from ancestral (A3) lines and from 7 selected (S3) lines that had experienced 5 generations of selection in the three replicated dynamic landscapes (2xD1, 3xD5,2xD6) was sequenced (paired-end, 100 bp) using the Illumina Highseq 2000 Instrument. Single nucleotide polymorphisms and TE insertions were mapped with respect to the recombinant reference genome and compared between selected and ancestral lines.
2014-09-01 | E-GEOD-47490 | biostudies-arrayexpress
Project description:Insulators are considered as chromosome organizers. BEAF, one of the insulator proteins, is highly conserved in Drosophila speies but also limited to Drosophila spcies. BEAF associates with TSS of active genes. Comparative study of BEAF binding landscapes in four Drosophila species reveals BEAF association with gene pairs, and the results suggest the role of gain or loss of BEAF binding during the speciation of Drosophila species. DNA sample from ChIP for BEAF and input are collected for each of four Drosophila species
2012-08-03 | E-GEOD-35648 | biostudies-arrayexpress
Project description:Upon colonizing new habitats invasive species face a series of new selection pressures as a result of changing abiotic conditions and novel biotic interactions with native species. These new selection pressures can be accommodated by different mechanism that act on different levels and across different time scales: 1) By changing transcriptomic profiles species can react by plasticity within individual physiological limitations. 2) Invasive populations can adapt by fixing beneficial genetic variants in response to the newly encountered selection pressures. Here, we compare the genomic and transcriptomic landscapes of two independent invasions of the Pacific Oyster Crassostrea gigas into the North Sea. In detail, we combine high density full genome resequencing and low density ddRAD on the genomic level with RNAseq on the transcriptomic level to reveal outlier loci (SNPs) indicative of adaptation, as well as transcriptomic profiles from a translocation experiment to show immediate physiological reactions. The low congruence between differentially regulated genes and outlier loci indicates that different processes act on the different time scales. By contrasting population outlier loci and population specific transcriptomic profiles we can thus identify relevant processes acting during different phases of the invasive process, which will allow to take a glimpse at the traits and processes characterizing successful invasions.
2020-09-30 | E-MTAB-9186 | biostudies-arrayexpress