Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Feces metagenome

ABSTRACT: feces 16S rDNA gene-sequencing reads

PROVIDER: PRJNA794329 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR17458336_1.fastq.gz	Fastqsanger.gz
	SRR17458336_2.fastq.gz	Fastqsanger.gz
	SRR17458337_1.fastq.gz	Fastqsanger.gz
	SRR17458337_2.fastq.gz	Fastqsanger.gz
	SRR17458338_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 48

Similar Datasets

Feces 16S rRNA seq of mice treated by AZ1 with 2.5% DSS or H2O

Project description:Feces 16s rRNA seq experiments is required to demonstrate the AZ1 doesn’t impact the intestinal microbiota.

2020-02-14 | GSE143003 | GEO

16S rRNA gene sequence analysis of feces samples from rats treated with paclitaxel or vehicle controls

Project description:To address the role of gut microbiota in the development of paclitaxel-induced peripheral neuropathy (PIPN), we performed 16S rRNA sequencing analysis of feces samples at 14 days and 28 days after the initiation of paclitaxel or vehicle injections.

2023-10-16 | E-MTAB-13426 | biostudies-arrayexpress

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Impact of fecal microbiota transplantation (FMT) in 3 days-ABX-treated recipient mice using feces from 6 NSCLC patients at diagnosis.

Project description:This study aimed to analyze changes in gut microbiota composition in mice after transplantation of fecal microbiota (FMT, N = 6) from the feces of NSCLC patients by analyzing fecal content using 16S rRNA sequencing, 10 days after transplantation. Specific-pathogen-free (SPF) mice were used for each experiments (N=4) as controls.

2023-07-01 | E-MTAB-12812 | biostudies-arrayexpress

Nobiletin ameliorates high fat-induced disruptions in rhythmic glucagon-like peptide-1 secretion - 16S

Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.

2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress

16s rRNA-young and old mouse gut microbiota-stroke

Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18～20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.

2021-10-15 | E-MTAB-10837 | biostudies-arrayexpress

human gut metagenome

Project description:Human feces metagenome 16s rDNA sequencing

| PRJNA307231 | ENA

feces metagenome breed:Sus scrofa domestica

Project description:16S rDNA sequence reads of faeces

| PRJNA547773 | ENA

Extracellular miRNAs in serum and feces of mice exposed to high-dose radiation

Project description:Exposure to high-dose radiation causes life-threatening serious intestinal damage. Histological analysis is the most accurate method for judging the extent of intestinal damage after death. However, it is difficult to predict the extent of intestinal damage to body samples. Here we focused on extracellular microRNAs (miRNAs) released from cells and investigated miRNA species that increased or decreased in serum and feces using a radiation-induced intestinal injury mouse model. A peak of small RNA of 25–200 nucleotides was detected in mouse serum and feces 72 h after radiation exposure, and miRNA presence in serum and feces was inferred. MiRNAs expressed in the small intestine and were increased by more than 2.0-fold in serum or feces following a 10 Gy radiation exposure were detected by microarray analysis and were 4 in serum and 19 in feces. In this study, miR-375-3p, detected in serum and feces, was identified as the strongest candidate for a high-dose radiation biomarker in serum and/or feces using a radiation-induced intestinal injury model.

2023-12-15 | GSE247876 | GEO

feces metagenome

Project description:16S rRNA amplicon raw sequence reads from human infant feces samples

| PRJNA554596 | ENA