Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Lacticaseibacillus paracasei subsp. paracasei strain:Indonesian healthy infant fecal samples | isolate:Indonesian healthy infant fecal samples

ABSTRACT: Lacticaseibacillus paracasei subsp. paracasei strain:Indonesian healthy infant fecal samples | isolate:Indonesian healthy infant fecal samples Genome sequencing

PROVIDER: PRJNA826272 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Indo_mother-infant microbiome

Project description:Indonesian mother-infant microbiome

| PRJEB34323 | ENA

Transcription profile of dendritic cell line D1 treated with Lactobacillus Paracasei

Project description:Mouse D1 dendritic cells treated with Lactobacillus Paracasei at different time points: 0h, 2h, 4h, 8h, 12h, 24h

2012-03-28 | E-MEXP-3157 | biostudies-arrayexpress

The Healthy Infant Nasal Transcriptome: A Benchmark Study

Project description:The Healthy Infant Nasal Transcriptome: A Benchmark Study

| PRJNA431687 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Metagenome collected from infant and adult human fecal samples

Project description:Metagenome from infant and adult human fecal samples

| PRJNA20077 | ENA

Analysis of infant gut microbiome reveals metabolic functional roles associated with healthy and atopic dermatitis using metaproteomics

Project description:Metaproteomics approach was used to investigate the microbial community and diversity of the infant gut to identify different key proteins with metabolic functional roles in the microbiomes of healthy and atopic dermatitis infants in a Thai population-based birth cohort.

2020-09-06 | PXD021324 | JPOST Repository

Genotyping of human Infant ALL samples to detect MLL-cooperating aberrations

Project description:In this study we explored the genotype of Infant ALL to detect MLL-cooperating aberrations, hidden to conventional techniques. In order to limit further heterogeneity, we focused on patients carrying the t(4;11) translocation, the most frequent genetic abnormality in Infant ALL. Final aim was to get new insights into the leukemia pathogenesis of this rare and aggressive disease, as well as providing the basis for discovering new genes for targeted therapy.

2009-12-03 | E-TABM-511 | biostudies-arrayexpress

Identification of candidate genes involved in fructooligosaccharides (FOS) utilization by Lactobacillus paracasei

Project description:A shotgun microarray-based approach was used to identify candidate genes encoding the FOS utilization pathway in L. paracasei 1195. Differential expression profiles between cells grown on FOS and glucose provided a basis for identifying genes specifically induced by FOS. In addition, transcriptional analysis of cells grown on FOS or FOS + glucose allowed us to investigate the effect of catabolite repression on the expression of the FOS-induced genes. Keywords: gene identification

2006-12-06 | GSE5890 | GEO

Lactiplantibacillus plantarum strain:Growol (Indonesian fermented cassava) | isolate:Growol (Indonesian fermented cassava)

Project description:Lactiplantibacillus plantarum strain:Growol (Indonesian fermented cassava) | isolate:Growol (Indonesian fermented cassava) Genome sequencing

| PRJNA826210 | ENA

Fecal metatranscriptomics from healthy adults before and after supplementation with bovine milk oligosaccharides

Project description:Complex oligosaccharides found in human milk play a vital role in gut microbiome development for the human infant. Bovine milk oligosaccharides (BMO) have similar structures with those derived from human milk, but have not been well studied for their effects on the healthy adult human gut microbiome. Healthy human subjects consumed BMO over two-week periods at two different doses and provided fecal samples. Metatranscriptomics of fecal samples was conducted to determine microbial and host gene expression in response to the supplement. Fecal samples were also analyzed by mass spectrometry to determine levels of undigested BMO. No changes were observed in microbiome activity across all participants. Repeated sampling enabled subject-specific analyses: four of six participants had minor, yet statistically significant, changes in microbial activity. No significant change was observed in the gene expression of host cells in stool. Levels of BMO excreted in feces after supplementation were not significantly different from placebo and were not correlated with dosage or expressed microbial enzyme levels. Collectively, these data suggest that BMO is fully digested in the human gastrointestinal tract prior to stool collection. Participants’ gut microbiomes remained stable but varied between individuals. Additionally, the unaltered host transcriptome provides further evidence for the safety of BMO as a dietary supplement or food ingredient.

2020-02-18 | GSE108809 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data