Dataset Information

NuRD and CAF-1-mediated silencing of the D4Z4 array is modulated by DUX4-induced MBD3L proteins

ABSTRACT: This study was designed to identify proteins associated with the D4Z4 macrosatellite repeat array in human muscle cells using a locus-specific proteomics approach (enChIP-MS).

INSTRUMENT(S): LTQ Orbitrap Elite

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Cell Culture

SUBMITTER: Yuko Ogata

LAB HEAD: Stephen J. Tapscott

PROVIDER: PXD006839 | Pride | 2018-03-02

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	AC101415_102215_MB135_plus_dCas9_D4Z4_1_plus_3_1FA.msf	Msf
	AC101415_102215_MB135_plus_dCas9_D4Z4_1_plus_3_1FA.raw	Raw
	AC101415_102215_MB135_plus_dCas9_D4Z4_1_plus_3_2FA.msf	Msf
	AC101415_102215_MB135_plus_dCas9_D4Z4_1_plus_3_2FA.raw	Raw
	AC101415_102215_MB135_plus_dCas9_D4Z4_2.msf	Msf

Items per page:

1 - 5 of 23

Publications

NuRD and CAF-1-mediated silencing of the D4Z4 array is modulated by DUX4-induced MBD3L proteins.

Campbell Amy E AE Shadle Sean C SC Jagannathan Sujatha S Lim Jong-Won JW Resnick Rebecca R Tawil Rabi R van der Maarel Silvère M SM Tapscott Stephen J SJ

eLife 20180313

The DUX4 transcription factor is encoded by a retrogene embedded in each unit of the D4Z4 macrosatellite repeat. DUX4 is normally expressed in the cleavage-stage embryo, whereas chromatin repression prevents DUX4 expression in most somatic tissues. Failure of this repression causes facioscapulohumeral muscular dystrophy (FSHD) due to mis-expression of DUX4 in skeletal muscle. In this study, we used CRISPR/Cas9 engineered chromatin immunoprecipitation (enChIP) locus-specific proteomics to charact ...[more]

PMID: 29533181

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Project description:DUX4 is a double homeodomain transcription factor whose misexpression in the muscle causes facioscapulohumeral muscular dystrophy (FSHD). The transcriptional activity of DUX4 has been extensively characterized, and is thought to be the primary driver of FSHD pathogenesis. Yet, DUX4 expression lowers the protein level of an RNA quality control factor, UPF1, without affecting its transcript level, hinting at post-transcriptional regulatory activity downstream of DUX4 expression. How extensive the post-transcriptional activity of DUX4 is, and how relevant it is to FSHD pathogenesis, is unknown. In order to gain insight into DUX4-induced post-transcriptional gene regulation, we measured transcript and protein levels in DUX4 expressing cells via RNA-seq and SILAC-based quantitative mass spectrometry, respectively. We show that DUX4 transcriptional targets are robustly translated, including those genes previously identified as potential FSHD biomarkers. However, comparing the overall pattern of gene expression changes for RNA versus protein reveals striking differences in the most highly activated pathways, with the former showing changes in RNA processing and splicing, and the latter affecting the humoral immune response, proteolysis and exocytosis, among other pathways. Consistent with a misregulation of exocytosis, fluorescence imaging shows fragmented golgi apparatus in DUX4-expressing cells. Of the genes that showed discordant RNA and protein expression levels, post-transcriptional buffering was particularly evident for genes involved in stress response and may explain why DUX4-expressing cells succumb to toxicity despite robust transcriptional activation of stress response genes. Moreover, several genes involved in RNA decay including UPF1, UPF3B, SMG6 and XRN1 showed downregulation at the protein level, which may explain the massive inhibition of RNA quality control in DUX4-expressing cells. These results highlight the importance of considering post-transcriptional gene regulation in DUX4-expressing cells in order to fully understand the FSHD disease process.

Project description:Protein translational machinery is an important component of the proteostasis network that maintains cellular proteostasis and regulates aging and other cellular processes. Ample evidence indicates that inhibition of translation initiation factor activities enhances stress resistance in model organisms. Eukaryotic translation initiation factor 5B (eIF5B) acts by joining the pre-40S subunit with the 60S ribosomal unit to form an 80S-like complex during protein translational initiation. Reduced eIF5B expression may disrupt proteostasis and trigger cellular processes associated with stress responses. In this study, the physiological effects of altered eIF5B expression were examined in 293T and HepG2 cells. Cells with eIF5B-knockdown (eIF5B-KN) grew more slowly than control cells, and had a lower level of intracellular reactive oxygen species (ROS), increased resistance to oxidative stress and enhanced autophagy. Proteomic analysis showed that eIF5B knockdown resulted in upregulation of 88 proteins and downregulation of 130 proteins compared with control cells. The differentially expressed proteins were associated with diverse cellular processes including amino acid metabolism, RNA processing and protein metabolism, and DNA synthesis. Autonomous downregulation of the mitogen-activated protein kinase (MAPK) signaling pathway was identified as confirmed by western blotting and qPCR. We proposed that deactivation of MAPK pathway modulated proteostasis and induced prolonged S-phase of the cell-cycle, contributing to the slow growth of eIF5B-KN cells. eIF5B silencing also inactivated the mTOR pathway, downregulated glutamine transporters, enhanced autophagy, and decreased 28S rRNA and 5.8S rRNA expression levels which were reversed by restoration of eIF5B expression. Taken together, these results suggest that eIF5B silencing provides a negative feedback to deactivate MAPK signaling, leading to reduced cell growth. These findings provide a useful resource to further biological exploration of the functions of protein synthesis in regulation of proteostasis and stress responses.