Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

LC-MSMS of primary AML class I immunopeptidome (mTECs k-mer depletion approach)

ABSTRACT: The development of therapeutic anticancer vaccines calls for the identification of tumor-specific antigens (TSAs). Though a combination of four cutting-edge proteogenomic approaches, we performed a deep exploration of the MHC-I presented peptides (MAPs) of 19 acute myeloid leukemia (AML) patients and identified various TSAs that could serve for the design of an anti-AML vaccine.

INSTRUMENT(S): Q Exactive HF

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Mononuclear Cell, Bone Marrow, Blood

DISEASE(S): Acute Myeloid Leukemia

SUBMITTER: Courcelles Mathieu

LAB HEAD: Pierre Thibault

PROVIDER: PXD018540 | Pride | 2021-03-19

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	05H143_10__PP158_id_210.fasta	Fasta
	05H143_131118_1.mgf	Mgf
	05H143_131118_1.raw	Raw
	05H143_131118_2.mgf	Mgf
	05H143_131118_2.raw	Raw

Items per page:

1 - 5 of 122

Publications

Atypical acute myeloid leukemia-specific transcripts generate shared and immunogenic MHC class-I-associated epitopes.

Ehx Grégory G Larouche Jean-David JD Durette Chantal C Laverdure Jean-Philippe JP Hesnard Leslie L Vincent Krystel K Hardy Marie-Pierre MP Thériault Catherine C Rulleau Caroline C Lanoix Joël J Bonneil Eric E Feghaly Albert A Apavaloaei Anca A Noronha Nandita N Laumont Céline M CM Delisle Jean-Sébastien JS Vago Luca L Hébert Josée J Sauvageau Guy G Lemieux Sébastien S Thibault Pierre P Perreault Claude C

Immunity 20210318 4

Acute myeloid leukemia (AML) has not benefited from innovative immunotherapies, mainly because of the lack of actionable immune targets. Using an original proteogenomic approach, we analyzed the major histocompatibility complex class I (MHC class I)-associated immunopeptidome of 19 primary AML samples and identified 58 tumor-specific antigens (TSAs). These TSAs bore no mutations and derived mainly (86%) from supposedly non-coding genomic regions. Two AML-specific aberrations were instrumental in ...[more]

PMID: 33740418

Similar Datasets

LC-MSMS of primary AML class I immunopeptidome (mTECs+MPCs k-mer depletion approach)

Project description:The development of therapeutic anticancer vaccines calls for the identification of tumor-specific antigens (TSAs). Though a combination of four cutting-edge proteogenomic approaches, we performed a deep exploration of the MHC-I presented peptides (MAPs) of 19 acute myeloid leukemia (AML) patients and identified various TSAs that could serve for the design of an anti-AML vaccine.

2021-03-19 | PXD018539 | Pride

LC-MSMS of primary AML class I immunopeptidome (differential k-mer expression approach)

2021-03-19 | PXD018543 | Pride

LC-MSMS of primary AML class I immunopeptidome (Canonical personalized proteome)

2021-03-19 | PXD018541 | Pride

LC-MSMS of primary AML class I immunopeptidome (ERE-derived MAPs identification approach)

2021-03-19 | PXD018542 | Pride

Deconvolving the recognition of DNA shape from sequence

Project description:Binding of transcription factors to DNA is mediated by the recognition of the chemical signatures of the DNA bases and the three-dimensional shape of the DNA molecule. The direct contribution of DNA shape to DNA-binding specificity has been difficult to assess, as DNA shape is a consequence of its sequence. Here, we teased apart these two modes of recognition in the context of Hox-DNA binding. We made a series of mutations in Hox residues that, in a co-crystal structure, only recognize DNA shape, and tested the effect on DNA binding preferences using SELEX-seq. Analysis of shape features of selected sequences revealed that these residues are both necessary and sufficient for selection of sequences with distinct shape features. We used statistical machine learning to show that the accuracy of binding specificity predictions improves by adding shape features to a model that only depends on sequence. We conclude that shape readout is a direct and critical component of binding site selection by Hox proteins. Three rounds of SELEX were performed on a series of Hox mutants as described in Slattery et al, Cell, 2011 (PMID 22153072) and Riley et al, Methods in molecular Biology, 2014 (PMID 25151169). Briefly, His-tagged Scr and Antp mutant proteins were incubated with a randomized 16mer oligonucleotide library, and bound DNA was amplified and sequenced as described (PMID 22153072, PMID 25151169).

2015-01-21 | E-GEOD-65073 | biostudies-arrayexpress

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

Project description:To define the sequence preference of SALL4 C2H2 zinc finger domains, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified SALL4 ZFC1, ZFC2 and ZFC4 domains combined with no protein control experiment.

2021-01-05 | E-MTAB-9236 | biostudies-arrayexpress

Endogenous siRNAs derived from transposons and mRNAs in Drosophila somatic cells

Project description:Small interfering RNAs (siRNAs) direct RNA interference (RNAi) in eukaryotes. In flies, somatic cells produce siRNAs from exogenous double-stranded RNA as a defense against viral infection. Here, we identify 21-nt long, endogenous siRNAs (endo-siRNAs) corresponding to transposons and heterochromatic sequences in the somatic cells of Drosophila melanogaster. We also detected endo-siRNAs complementary to mRNAs: these siRNAs disproportionately mapped to the complementary regions of overlapping mRNAs predicted to form dsRNA in vivo. Normal accumulation of somatic endo-siRNAs requires the siRNA-generating ribonuclease, Dicer-2, and the RNAi effector protein, Ago2. We propose that endo-siRNAs generated by the fly RNAi pathway silence selfish genetic elements in the soma much as piRNAs do in the germ line. Keywords: Small RNA detection and quantification. Small RNAs (18-30 nt) from fly heads (WT, ago2 mutants, dcr-2 homozygous and heterozygous mutants, and WT expressing an inverted repeat directed against exon 3 of the gene "white") and S2 cells (transgenic for a construct expressing siRNAs against white and GFP) were sequenced using a Solexa Genome Analyzer instrument. Raw sequence data files for this study are available for download from the SRA FTP site at ftp://ftp.ncbi.nlm.nih.gov/sra/Studies/SRP000/SRP000181

2008-04-10 | E-GEOD-11019 | biostudies-arrayexpress

Conserved functional antagonism between CELF and MBNL proteins regulates stem cell-specific alternative splicing and regeneration in planarians

Project description:Understanding gene regulation in stem cells is key to understanding stem cell biology. Contrary to transcriptional regulation the function of alternative splicing (AS) in stem cells is poorly understood. Here we study function and mechanisms of AS in a powerful in vivo model for stem cell biology, the planarian S. mediterranea. Knockdown of AS factors, computational analyses of massive RNA-sequencing data, phenotyping, and biochemical binding assays revealed a stem cell specific AS program comprising hundreds of alternative exons, intron retention events, and microexons. The conserved AS factors CELF/MBNL are main regulators of this program. We show that they antagonize each other by directly promoting or repressing stem cell specific AS events. Knockdown of CELF/MBNL leads to defective regeneration by affecting self-renewal and differentiation, respectively. Thus, AS is of key importance for stem cell regulation in vivo and antagonistic regulation by CELF/MBNL is likely an ancestral feature of animal stem cells. mRNA profiles of various samples of planarian cells, including control and knockdowns of key splicing factors in whole worms, and FACS-purified fractions

2016-08-01 | E-GEOD-75594 | biostudies-arrayexpress

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress

Muscleblind-like proteins regulate embryonic stem cell-specific alternative splicing and reprogramming I

Project description:Previous investigations of the core gene regulatory circuitry that controls embryonic stem cell (ESC) pluripotency have largely focused on the roles of transcription, chromatin and non- coding RNA regulators. Alternative splicing (AS) represents a widely acting mode of gene regulation, yet its role in the regulation of ESC pluripotency and differentiation is poorly understood. Here, we identify the Muscleblind-like RNA binding proteins, MBNL1 and MBNL2, as conserved and direct negative regulators of a large program of AS events that are differentially regulated between ESCs and other cell types. Knockdown of MBNL proteins in differentiated cells causes switching to an ESC-like AS pattern for at least half of these AS events. Among the events is an ESC-specific AS switch in the forkhead family transcription factor FOXP1 that controls pluripotency. Consistent with a central and negative regulatory role for MBNL proteins in pluripotency, their knockdown significantly enhances the expression of key pluripotency genes and the formation of induced pluripotent stem cells (iPSCs) during somatic cell reprogramming. mRNA profiles of various embryonic stem cells, tissues and cell lines from human and mouse using high-throughput sequencing data and the role of MBNL proteins in regulation of ESC-differential alternative splicing

2013-06-26 | E-GEOD-45503 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data