Dataset Information

NP-6A4 activates a novel signaling network of protective autophagy in obese female rat heart and attenuates cardiac dysfunction and coronary microvascular damage

ABSTRACT: NP-6A4 activates a novel signaling network of protective autophagy in obese female rat heart and attenuates cardiac dysfunction and coronary microvascular damage

INSTRUMENT(S): timsTOF Pro

ORGANISM(S): Rattus Rattus (black Rat)

TISSUE(S): Heart

SUBMITTER: Brian Mooney

LAB HEAD: Lakshmi Pulakat

PROVIDER: PXD036596 | Pride | 2023-09-25

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	10_LP2_462_R4_389.d.zip	Other
	11_LP2_470_R5_390.d.zip	Other
	12_LP2_474_R6_391.d.zip	Other
	13_LP3_458_R1_393.d.zip	Other
	14_LP3_460_R2_394.d.zip	Other

Items per page:

1 - 5 of 19

Publications

Cardiovascular Protective Effects of NP-6A4, a Drug with the FDA Designation for Pediatric Cardiomyopathy, in Female Rats with Obesity and Pre-Diabetes.

Belenchia Anthony M AM Boukhalfa Asma A DeMarco Vincent G VG Mehm Alexander A Mahmood Abuzar A Liu Pei P Tang Yinian Y Gavini Madhavi P MP Mooney Brian B Chen Howard H HH Pulakat Lakshmi L

Cells 20230512 10

<h4>Background</h4>Obese and pre-diabetic women have a higher risk for cardiovascular death than age-matched men with the same symptoms, and there are no effective treatments. We reported that obese and pre-diabetic female Zucker Diabetic Fatty (ZDF-F) rats recapitulate metabolic and cardiac pathology of young obese and pre-diabetic women and exhibit suppression of cardio-reparative AT2R. Here, we investigated whether NP-6A4, a new AT2R agonist with the FDA designation for pediatric cardiomyopat ...[more]

PMID: 37408206

Similar Datasets

Project description:Plant and virus materials, inoculation and symptom evaluation Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA). Microarray sample preparation and determination of viral titers Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).

Project description:SARS-CoV-2 emerged in China at the end of 2019 and caused the global pandemic of COVID-19, a disease with high morbidity and mortality. While our understanding of this new virus is rapidly increasing, gaps remain in our understanding of how SARS-CoV-2 can effectively suppress host cell antiviral responses. Recent work on other viruses has demonstrated a novel mechanism through which viral proteins can mimic critical regions of human histone proteins. Histone proteins are responsible for governing genome accessibility and their precise regulation is critical for a cell’s ability to control transcription and respond to viral threats. Here, we show that the protein encoded by ORF8 (Orf8) in SARS-CoV-2 functions as a histone mimic of the ARKS motif in histone 3. Orf8 is associated with chromatin, binds to numerous histone-associated proteins, and is itself acetylated within the histone mimic site. Orf8 expression in cells disrupts multiple critical histone post-translational modifications (PTMs) including H3K9ac, H3K9me3, and H3K27me3 and promotes chromatin compaction while Orf8 lacking the histone mimic motif does not. Further, SARS-CoV-2 infection in human cell lines and postmortem patient lung tissue cause these same disruptions to chromatin. However, deletion of the Orf8 gene from SARS-CoV-2 largely blocks its ability to disrupt host-cell chromatin indicating that Orf8 is responsible for these effects. Finally, deletion of the ORF8 gene affects the host-cell transcriptional response to SARS-CoV-2 infection in multiple cell types and decreases the replication of SARS-CoV-2 in human induced pluripotent stem cell-derived lung alveolar type 2 (iAT2) pulmonary cells. These findings demonstrate a novel function for the poorly understood ORF8-encoded protein and a mechanism through which SARS-CoV-2 disrupts host cell epigenetic regulation. Finally, this work provides a molecular basis for the finding that SARS-CoV-2 lacking ORF8 is associated with decreased severity of COVID-19.

Project description:Hormesis is a dose response phenomenon characterized by a stimulation of an organismal response at low doses of a chemical and inhibition of the response (toxicity) at a higher dose. In the present study, Daphnia magna were exposed to the energetic compound 2,4,6-trinitrotoluene (TNT) for 21 days, and the endpoints survival, growth (length and dry weight), and reproduction (number of neonates per survivor) were assesed, identifying hormetic responses at the lower treatment levels. In order to elucidate the mechanisms leading to hormesis, microarray analysis was performed at 0.004 (hormetic), 0.12 (sometimes hormetic), and 1.85 (toxic) mg/L TNT. Functional and transcriptional benchmark dose analyses performed on differentially expressed genes suggested the involvement of lipid metabolism in hormetic responses and subsequently lipidomic analysis was performed on the same treatments. Lipid analysis supported the hypothesis that TNT exposure affected lipid metabolism, and showed that hormetic effects could be related to increases in some polyunsaturated fatty acids and ecosanoids known to be involved in Daphnia growth and reproduction. Chronic toxicity tests was designed to identify the hormetic range of D. magna responses to TNT. Daphnia magna younger than 24 h old and obtained from in-house cultures at the U.S. Army Engineer Research and Development Center, Environmental Laboratory (Vicksburg, MS) were used to initiate the bioassay. The experimental design consisted of one D. magna per test chamber and 10 test chambers per treatment level. In the microarray mass exposure, nominal treatment levels were 0.004, 0.02, 0.12, 0.44, and 1.85 mg/L. Based on the results of the testing in the 50 ml beakers, organisms from three treatments were selected for analysis of gene expression: 0.004, 0.12, and 1.85 mg/L. These treatments were selected to represent a hormetic concentration (0.004 mg/L), a toxic concentration (1.85 mg/L), and an intermediate concentration (0.12 mg/L). A total of 23 arrays used, with 5-6 replicates per each dose (solvent control, 0.004 mg/L, 0.12 mg/L, and 1.85 mg/L).

Project description:Paper Abstract. Extrapolating toxicological sensitivity information across species can require the use of highly conservative safety factors as prescribed by ecological risk assessment protocols. The objective of our study was to use multipule factors to understand the dynamics of stress responses by comparing ecotoxicological, developmental, and genomic data to quantitatively determine the relative sensitivity of two common model aquatic vertebrates to assess the potential for developing refined safety factors among species. Larval (3-d old) zebrafish (Danio rerio) and fathead minnows (Pimephales promelas) were concurrently exposed in 96-h static exposures to the widely-used military energetic compound cyclotrimethylenetrinitramine (RDX). Endpoints assessed included mortality, incidence of vertebral deformities, swimming behavior, and differential gene (transcript) expression. Analytically verified treatment concentrations ranged from 0.9 to 27.7 mg/L RDX. While RDX concentrations prepared for exposures included 0, 0.9, 1.8, 3.5, 7.5, 15.0, and 30.0 mg/L, analytically verified treatment concentrations were 0, 0.88, 1.75, 3.46, 6.96, 13.79, and 27.7 mg/L, respectively. Changes in prepared RDX concentrations and analytically verified treatment concentrations are a result of chemical breakdown, a well known characteristic of RDX Our results indicated a higher sensitivity to RDX in P. promelas than in D. rerio in both mortality (LOECs 13.79 and 27.7 mg/L, respectively) and vertebral deformity (LOECs 13.79 and >13.79, respectively) endpoints. Swimming behavior was assessed in 10 min behavioral trials using Noldus EthoVision® digital tracking software. Swimming behavior trials indicated non-significant trends of decreased velocity, distance moved, and increased meander (change in direction per cm traveled) for P. promelas. No such trends were apparent in D. rerio swimming behavior. A comprehensive genomic analysis is in progress to determine the genes, gene ontology elements, metabolic pathways and metabolic networks affected in common among species in the RDX exposure. Taken as a whole, the ecotoxicological, developmental and genomic results will provide valuable insights into the similarity in response among these fish species to RDX. Three-day-old fathead minnow (FHM, Pimephales promelas) or Zebrafish (ZF, Danio rerio) fry were exposed to either control water or one of six concentrations of RDX (0.9, 1.9, 3.8, 7.5, 15, or 27.7 mg/L) in 96-h exposures. However, microarray analysis was only performed on FHM exposed to 0, 0.9, 1.9, 7.5, or 15 mg/L RDX and ZF exposed to 0, 0.9, 1.9, 3.8, 7.5, or 15 mg/L RDX due to insufficient tissue for microarray analysis due to animal death at the other RDX concentrations. The experimental design was based on the U.S. EPA (2002) acute testing method for P. promelas, test method 2000.0 and included four replicates per treatment with ten fish per replicate. Whole fish (10 fish per replicate) were investigated for differential expression in response to RDX exposure.

Project description:Aphids, sap-sucking insects in the order Hemiptera, are among the most prolific insect vectors of plant viruses Plant viruses from the family Luteoviridae are transmitted exclusively by aphids in a circulative manner and cause significant crop yield losses. Circulative plant viruses must cross the aphid gut and other tissues prior to transmission to a new host plant. The discovery of proteins that control acquisition and transmission in the insect vector is the biggest challenge for the vector biology field and will have practical applications for growers by providing new molecular targets for the development of precision vector management tools. The green peach aphid, Myzus persicae, is a vector of the Potato leafroll virus (PLRV), a polerovirus in the Luteoviridae. PLRV transmission efficiency was significantly reduced when a clonal lineage of M. persicae was reared on turnip (T-Myzus) as compared to the weed physalis (P-Myzus). The effect on PLRV transmission efficiency was transient and caused by a host-switch response. Using 2-D DIGE, we revealed that the major difference in the proteome profile of P- and T-Myzus was the lysosomal cysteine protease cathepsin B, with multiple size and charge isoforms of this enzyme up-regulated in T-Myzus. Quantitative, shotgun proteomics revealed a specific upregulation in the expression of other lysosomal proteins in T-Myzus as compared to P-Myzus, including cathepsin B, cathepsin B-16, beta-glucuronidase, peroxidasin, legumain-like, and aminopeptidase-N. The titer of PLRV was over 1.5 fold higher in P-Myzus than in T-Myzus at 24h and 72h after the beginning of virus acquisition, suggesting that virus acquisition in P-Myzus was more efficient. Cathepsin B and PLRV localization were starkly different in P- and T-Myzus midguts, the site of PLRV acquisition into the insect. In P-Myzus midguts, an abundance of PLRV was observed inside midgut cells, and cathepsin B was sequestered in a subcellular compartment. In contrast, there is near complete co-localization of cathepsin B and PLRV at the cell membranes in viruliferous T-Myzus. Inhibition of cathepsin and other cysteine proteases with E64 restored the ability of T-Myzus to transmit PLRV in a dose-dependent manner, suggesting that the activities of lysosomal cysteine proteases at the cell membrane in T-Myzus is responsible for the change in virus transmission phenotype in these aphids. T-Myzus individuals weighed more and had more progeny than P-Myzus individuals. These data are all consistent with the hypothesis that there is an induction of lysosomal exocytos in the midgut of T-Myzus linked to the ability of the aphid to acquire PLRV. These data also show that the ability of the generalist aphid M. persicae to transmit PLRV is influenced by the host plant the aphids are reared on, information that is useful to growers for polerovirus management in field crops.