Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Targeting NLRP3 inhibits AML progression by inducing PERK/eIF2-mediated apoptosis

ABSTRACT: Hyperactivation of the NLRP3 inflammasome has been linked to disease progression in acute myeloid leukemia (AML). However, the precise mechanisms behind this pathology remain elusive. Here, we highlight not only a significant correlation between elevated NLRP3 expression and diminished overall survival in AML patients, but also a potential pathomechanism. We show that genetic deletion and pharmacological inhibition of NLRP3 leads to a reduction in AML cell survival by triggering apoptosis. Additionally, our proteomic analyses revealed NLRP3-dependent alterations in protein translation, substantiated by increased eIF2α phosphorylation in NLRP3-deficient AML cells. Furthermore, we show that inhibition of the eIF2α kinase PERK mitigates eIF2α phosphorylation and decreases apoptosis by reducing the expression of pro-apoptotic Bcl-2 family members to levels comparable to those of wild-type cells. Substantiating these observations, we found that deleting NLRP3 in engrafted AML cells led to reduced splenomegaly and AML cell infiltration into organs in mice. Taken together, our findings demonstrate that blocking NLRP3 induces apoptosis via PERK/eIF2, revealing a promising avenue for therapeutic intervention in AML.

INSTRUMENT(S): Q Exactive

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Cell Culture

SUBMITTER: Veronika Schäpertöns

LAB HEAD: Dr. Constantin

PROVIDER: PXD047745 | Pride | 2024-08-14

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	20191105_CoB_SR_Molm13_NLRP3_CRISPR_5ug_001.raw	Raw
	20191105_CoB_SR_Molm13_NLRP3_CRISPR_5ug_002.raw	Raw
	20191105_CoB_SR_Molm13_NLRP3_CRISPR_5ug_003.raw	Raw
	OTHER_txt.zip	Other
	SEARCH_search.zip	Other

Items per page:

1 - 5 of 6

Similar Datasets

Cue-induced modulation of eIF2α-eIF2Bε underlies axonal translation up-regulation in neural wiring

Project description:Local protein synthesis is rapidly regulated by extrinsic signals during neural wiring but the translational control mechanisms remain elusive. Here, we show that the guidance cue Sema3A, but not Slit1, elicits precise spatiotemporal control of the phosphorylation of the translation initiation factor, eIF2α, in axonal growth cones via the Unfolded Protein Response (UPR) kinase PERK. Strikingly, in contrast to the canonical UPR signaling, we find that the Sema3A-induced eIF2α phosphorylation bypasses the conventional global translational repression and underlies a burst in axonal protein synthesis, mediated by differential eIF2B activity. Ultrasensitive proteomics on somaless axons reveals a subset of 75 proteins translationally regulated via Sema3A-p-eIF2α, including several proteostasis- and actin cytoskeleton-related nascent proteins. Finally, in vivo experiments provide evidence that eIF2α phosphorylation drives the formation of the retinotectal axon projection. Thus, specific extracellular cues can trigger non-canonical PERK-eIF2α-eIF2B signaling leading to subcellular dynamic remodeling of the nascent proteome required for neural wiring.

2019-01-02 | PXD009250 | Pride

Pharmacological induction of selective endoplasmic reticulum retention as a novel strategy for cancer therapy

Project description:We analysed the difference in the surface proteome of human cells that were either subjected to ER stress (induced by thapsigargin (Tg)) only or were additionally treated with a pharmacological inhibitor against the eIF2α kinase PERK, which is localized in the endoplasmic reticulum. Compared to single ER stress, several important plasma-membrane associated kinases, showed a significant downregulation under PERK inhibition.

2020-03-02 | PXD014709 | Pride

Neurons shift translational control to secure proteostatic resilience during ER stress

Project description:Proteostasis is essential for survival and particularly important for highly specialized post mitotic cells like neurons. Transient reduction of protein synthesis by protein kinase R–like endoplasmic reticulum (ER) kinase (PERK)-mediated phosphorylation of eukaryotic translation initiation factor 2α (eIF2α) is a major proteostatic survival response during ER stress. Paradoxically, neurons are remarkably tolerant to PERK dysfunction, which suggests the existence of cell type-specific mechanisms that secure proteostatic stress resilience. We employed PERK-deficient neuron and astrocyte monocultures to investigate the mechanisms underlying neuron-specific ER stress resilience in the absence of PERK.

2022-06-13 | GSE200742 | GEO

ISR target genes in the liver of mock-injected and AP20187-treated mice of wildtype and Atf4-/- genotype

Project description:The molecular mechanisms linking the stress of unfolded proteins in the endoplasmic reticulum (ER stress) to glucose intolerance in obese animals are poorly understood. In this study enforced expression of a translation initiation 2α (eIF2α)-specific phosphatase, GADD34, was used to selectively compromise signaling in the eIF2(αP)-dependent arm of the ER unfolded protein response in liver of transgenic mice. The transgene resulted in lower liver glycogen levels and susceptibility to fasting hypoglycemia in lean mice and glucose tolerance and diminished hepato-steatosis in animals fed a high fat diet. Attenuated eIF2(αP) correlated with lower expression of the adipogenic nuclear receptor PPARγ and its upstream regulators, the transcription factors C/EBPα and C/EBPβ, in transgenic mouse liver, whereas eIF2α phosphorylation promoted C/EBP translation in cultured cells and primary hepatocytes. These observations suggest that eIF2(αP)-mediated translation of key hepatic transcriptional regulators of intermediary metabolism contributes to the detrimental consequences of nutrient excess. Keywords: genotype comparison The low expressing Ttr::Fv2E-Perk transgene (#58) was bred into the Atf4 knockout strain and the derivative compound heterozygous mice (in the mixed FvB/n; Swiss Webster background) were backcrossed to the Atf4+/- parental stock and Ttr::Fv2E-PERK positive siblings with Atf4+/+ and Atf4-/- genetypes were analyzed.

2011-12-23 | E-GEOD-11116 | biostudies-arrayexpress

The noncanonical cGAS-STING-PERK pathway enables a selective translation program and underlies organ fibrosis [STING2]

Project description:Innate DNA sensing via the cGAS-STING pathway surveys both microbial invasion and cellular damage, constituting a ubiquitous mechanism for host defense and tissue homeostasis. However, very little is known about the signaling mechanism(s) and physiological impacts downstream of cGAS-STING signaling and independent of the classical TBK1-IRF3-IFN cascade. Here, we identified an unrecognized STING-PERK-eIF2α signaling axis that was specific and controlled cap-dependent translation, a fundamental cellular process. STING, upon activation by 2'3'-cyclic GMP-AMP (cGAMP), robustly bound and directly activated the endoplasmic reticulum (ER)-located kinase PERK, and this process was upstream of IRF3 activation and independent of the unfolded protein response (UPR) and TBK1/IKKε. Innate DNA sensing suppressed global translation programs but selectively ensured the activation of some pathways by PERK-mediated eIF2α phosphorylation and the rapid regulation of protein synthesis, enabling translational modulation of immune responses. Notably, the STING-PERK-eIF2α axis is an evolutionarily primitive component of STING-TBKI-IRF3-IFN signaling and is physiologically critical in pulmonary and renal fibrosis as well as in the regulation of cellular senescence. Therefore, these findings establish the first noncanonical pathway of the cGAS-STING mechanism and demonstrate the physiological importance of this STING-triggered selective translation, which we propose as a promising therapeutic target for fibrotic diseases.

2022-03-07 | GSE165910 | GEO

The noncanonical cGAS-STING-PERK pathway enables a selective translation program and underlies organ fibrosis

2024-01-18 | GSE165123 | GEO

The eIF2 kinase PERK and the integrated stress response facilitate activation of ATF6 during endoplasmic reticulum stress

Project description:Disruptions of the endoplasmic reticulum (ER) that perturb protein folding cause ER stress and elicit an unfolded protein response (UPR) that involves translational and transcriptional changes in gene expression aimed at expanding the ER processing capacity and alleviating cellular injury. Three ER stress sensors PERK, ATF6, and IRE1 implement the UPR. PERK phosphorylation of eIF2 during ER stress represses protein synthesis, which prevents further influx of ER client proteins, along with preferential translation of ATF4, a transcription activator of the integrated stress response. In this study we show that the PERK/eIF2α~P/ATF4 pathway is required not only for translational control, but also activation of ATF6 and its target genes. The PERK pathway facilitates both the synthesis of ATF6 and trafficking of ATF6 from the ER to the Golgi for intramembrane proteolysis and activation of ATF6. As a consequence, liver-specific depletion of PERK significantly reduces both the translational and transcriptional phases of the UPR, leading to reduced protein chaperone expression, disruptions of lipid metabolism, and enhanced apoptosis. These findings show that the regulatory networks of the UPR are fully integrated, and helps explain the diverse pathologies associated with loss of PERK. 14 gene expression arrays, 3 WT control arrays; 3 lsPERK control arrays; 4 WT Treated arrays; 4 lsPERK treated arrays. Comparison of gene expression profiles for treated vs control in wildtype and knock-out.

2012-01-20 | E-GEOD-29929 | biostudies-arrayexpress

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

Human AML cell lines LC-MS/MS - Performance of Super-SILAC based quantitative proteomics for comparison of different acute myeloid leukemia (AML) cell lines

Project description:As a direct consequence of the high diversity of the aggressive blood cancer acute myeloid leukemia (AML), proteomic samples from patients are strongly heterogeneous, rendering their accurate relative quantification challenging. In the present study, we investigated the benefits of using a super-SILAC mix of AML derived cell lines as internal standard for quantitative shotgun studies. The Molm-13, NB4, MV4-11, THP-1, and OCI-AML3 cell lines were selected for their complementarity with regard to clinical, cytogenetic and molecular risk factors used for prognostication of AML patients. The resulting internal standard presents a high coverage of the AML proteome compared to single cell lines allied with high technical reproducibility, thus enabling its use for AML patient comparison. This was confirmed by comparing the protein regulation between the five cell lines and applying the internal standard to patient material.

2014-07-15 | PXD000441 | Pride

FAM69C functions as a kinase for eIF2α and promotes stress granule assembly

Project description:Stress granules are dynamic cytoplasmic ribonucleoprotein granules that assemble in response to cellular stress. Aberrant formation of stress granules has been linked to neurodegenerative diseases. However, the molecular mechanisms underlying the initiation of stress granules remain elusive. Here we report that the brain-enriched protein kinase FAM69C promotes stress granule assembly through phosphorylation of eukaryotic translation initiation factor 2 (eIF2α). FAM69C physically interacts with eIF2α and functions as a stress-specific kinase for eIF2α, leading to stress-induced protein translation arrest and stress granule assembly. Primary microglia derived from Fam69c knockout mice exhibit aberrant stress granule assembly in response to oxidative stress and ATP. Defective stress granule assembly in microglia correlates with the formation of ASC specks and NLRP3 inflammasome activation, whereas induction of stress granule precludes inflammasome formation. Consistently, increased NLRP3 levels, caspase-1 cleavage and Il18 expression corroborate microglia-associated neuroinflammation in aged Fam69c knockout mice. Our study demonstrates that FAM69C is critical for stress granule assembly and suggests its role in the regulation of microglia function.

2023-04-21 | PXD037697 | Pride