Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Mouse gut metagenome

ABSTRACT: 16S rDNA V3-V4 region amplicon sequencing of gut microbiota of inulin-fed mice

PROVIDER: PRJDB13048 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	DRR351786_1.fastq.gz	Fastqsanger.gz
	DRR351786_2.fastq.gz	Fastqsanger.gz
	DRR351787_1.fastq.gz	Fastqsanger.gz
	DRR351787_2.fastq.gz	Fastqsanger.gz
	DRR351788_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

mouse gut metagenome

Project description:16S rDNA V4 region amplicon sequencing of mice colonic microbiota

| PRJDB4266 | ENA

mouse gut metagenome

Project description:Sequencing of the V3-V4 region of 16S rDNA genes of feces from mice

| PRJNA428592 | ENA

ceae09f4-f021-444d-b025-bee14880fa30 - samples

Project description:16S rDNA amplicon sequencing of 196 human fecal samples of an Inulin cross-over trial in healthy, mildly constipated individuals.

| EGAD00001004956 | EGA

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

First exploration of the altered microbial gut-lung axis in the pathogenesis of human refractory chronic cough

Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.

2024-04-17 | GSE240646 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

16S rDNA sequencing of BALB/c and C57BL/7 mouse gut microbiomes

Project description:Age-dependent changes of the gut-associated microbiome have been linked to increased frailty and systemic inflammation. This study found that age-associated changes of the gut microbiome of BALB/c and C57BL/6 mice could be reverted by co-housing of aged (22 months old) and adult (3 months old) mice for 30-40 days or faecal microbiota transplantation (FMT) from adult into aged mice. This was demonstrated using high-throughput sequencing of the V3-V4 hypervariable region of bacterial 16S rRNA gene isolated from faecal pellets collected from 3-4 months old adult and 22-23 months old aged mice before and after co-housing or FMT.

2019-05-08 | E-MTAB-7750 | biostudies-arrayexpress

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

Multi-modal single cell analysis reveals gut microbiota reshapes brain immune landscape in aged mouse model.

Project description:We used 16S V3/V4 region amplification to evaluate the composition of bacteria species in mouse fecal pellets. Fecel pellets were collected from young-adult (12 weeks old) wild type C57Bl/6 mice and aged (72 weeks old) wild type C57Bl/6 mice after 21 days of vehicle or antibiotics treatment (to induce gut microbiota depletion). In one sequencing round, we sequenced a total of 12 different fecal samples (3 young control, 3 aged control, 3 young depleted gut microbiota (ABX) and 3 aged depleted gut microbiota (ABX)). Amplicons were indexed using the Nextera XT Index Kit and pooled into a library for Illumina sequencing.

2020-11-03 | GSE160628 | GEO

mouse metagenome

Project description:Sequencing of the V3-V4 region of 16S rDNA genes of 16 feces from mice

| PRJNA433276 | ENA