Freshwater metagenome
Ontology highlight
ABSTRACT:
PROVIDER: PRJDB14697 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.
2016-01-01 | GSE73842 | GEO
Project description:Iron-rich pelagic aggregates (iron snow) were collected directly onto silicate glass filters using an electronic water pump installed below the redoxcline. RNA was extracted and library preparation was done using the NEBNext Ultra II directional RNA library prep kit for Illumina. Data was demultiplied by GATC sequencing company and adaptor was trimmed by Trimgalore. After trimming, data was processed quality control by sickle and mRNA/rRNA sequences were sorted by SortmeRNA. mRNA sequences were blast against NCBI-non redundant protein database and the outputs were meganized in MEGAN to do functional analysis. rRNA sequences were further sorted against bacterial/archeal 16S rRNA, eukaryotic 18S rRNA and 10,000 rRNA sequences of bacterial 16S rRNA, eukaryotic 18S rRNA were subset to do taxonomy analysis.
2021-10-15 | E-MTAB-9686 | biostudies-arrayexpress
Project description:Nitrate-reducing iron(II)-oxidizing bacteria are widespread in the environment contribute to nitrate removal and influence the fate of the greenhouse gases nitrous oxide and carbon dioxide. The autotrophic growth of nitrate-reducing iron(II)-oxidizing bacteria is rarely investigated and poorly understood. The most prominent model system for this type of studies is enrichment culture KS, which originates from a freshwater sediment in Bremen, Germany. To gain insights in the metabolism of nitrate reduction coupled to iron(II) oxidation under in the absence of organic carbon and oxygen limited conditions, we performed metagenomic, metatranscriptomic and metaproteomic analyses of culture KS. Raw sequencing data of 16S rRNA amplicon sequencing, shotgun metagenomics (short reads: Illumina; long reads: Oxford Nanopore Technologies), metagenome assembly, raw sequencing data of shotgun metatranscriptomes (2 conditions, triplicates) can be found at SRA in https://www.ncbi.nlm.nih.gov/bioproject/PRJNA682552. This dataset contains proteomics data for 2 conditions (heterotrophic and autotrophic growth conditions) in triplicates.
2021-05-17 | PXD023186 | Pride
Project description:Gas hydrates, also known as clathrates, are cages of ice-like water crystals encasing gas molecules such as methane (CH4). Despite the global importance of gas hydrates, their microbiomes remain mysterious. Microbial cells are physically associated with hydrates, and the taxonomy of these hydrate-associated microbiomes is distinct from non-hydrate-bearing sites. Global 16S rRNA gene surveys show that members of sub-clade JS-1 of the uncultivated bacterial candidate phylum Atribacteria are the dominant taxa in gas hydrates. The Atribacteria phylogeny is highly diverse, suggesting the potential for wide functional variation and niche specialization. Here, we examined the distribution, phylogeny, and metabolic potential of uncultivated Atribacteria in cold, salty, and high-pressure sediments beneath Hydrate Ridge, off the coast of Oregon, USA, using a combination of 16S rRNA gene amplicon, metagenomic, and metaproteomic analysis. Methods were developed to extract bacterial cellular protein from these sediments, as outlined below. Sample Description Three sediments samples were collected from beneath Hydrate Ridge, off the coast of Oregon, USA. Sediments were cored at ODP site 1244 (44°35.1784´N; 125°7.1902´W; 895 m water depth) on the eastern flank of Hydrate Ridge ~3 km northeast of the southern summit on ODP Leg 204 in 2002 and stored at -80°C at the IODP Gulf Coast Repository. E10H5 sediment is from 68.5 meters below sediment surface interface C1H2 sediment is from 2 meters below sediment surface interface. C3H4 sediment is from 21 meters below sediment surface interface.
2020-01-22 | PXD012479 | Pride
Project description:Ghana water distribution system 16s amplicon sequencing
| PRJNA480305 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles. A total of 56 samples were collected that represent water and sediment samples from 14 sample sites over two different time points (November 18 and 25, 2011).
2016-07-03 | E-GEOD-73842 | biostudies-arrayexpress