Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.
Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
Project description:Iron-rich pelagic aggregates (iron snow) were collected directly onto silicate glass filters using an electronic water pump installed below the redoxcline. RNA was extracted and library preparation was done using the NEBNext Ultra II directional RNA library prep kit for Illumina. Data was demultiplied by GATC sequencing company and adaptor was trimmed by Trimgalore. After trimming, data was processed quality control by sickle and mRNA/rRNA sequences were sorted by SortmeRNA. mRNA sequences were blast against NCBI-non redundant protein database and the outputs were meganized in MEGAN to do functional analysis. rRNA sequences were further sorted against bacterial/archeal 16S rRNA, eukaryotic 18S rRNA and 10,000 rRNA sequences of bacterial 16S rRNA, eukaryotic 18S rRNA were subset to do taxonomy analysis.
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles. A total of 56 samples were collected that represent water and sediment samples from 14 sample sites over two different time points (November 18 and 25, 2011).
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.