Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

2nd_Hemmingsen_Dugout_Study_Sept30_16

ABSTRACT: 16S rRNA amplicons for dugout DNA samples - primers removed.

PROVIDER: PRJEB15581 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	ERR1665671.fastq.gz	Fastqsanger.gz
	ERR1665672.fastq.gz	Fastqsanger.gz
	ERR1665673.fastq.gz	Fastqsanger.gz
	ERR1665674.fastq.gz	Fastqsanger.gz

Items per page:

1 - 4 of 4

Similar Datasets

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

A phylogenetic microarray targeting 16S rRNA genes from the bacterial division Acidobacteria

Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction A ten chip study using PCR amplicons from cloned 16S rRNA genes and from diverse soil 16S rRNAs, with PCR primers specific to the Division Acidobacteria. Each chip measures the signal from 42,194 probes (in triplicate) targeting Acidobacteria division, subdivision, and subclades as well as other bacterial phyla. All samples except one (GSM464591) include 2.5 M betaine in the hybridization buffer. Pair files lost due to a computer crash.

2010-06-24 | E-GEOD-18711 | biostudies-arrayexpress

The human Gut Chip M-bM-^@M-^\HuGChipM-bM-^@M-^], an explorative phylogenetic microarray for determining gut microbiome diversity at Family level

Project description:A phylogenetic microarray targeting 66 families described in the human gut microbiota has been developped aud used to monitor the gut microbiota's structure and diversity. The microarray format provided by Agilent and used in this study is 8x15K. A study with a total of 4 chips was realized. Arrays 1 and 2: Hybridization with 100ng of labelled 16S rRNA gene amplicons from a mock community sample and 250ng of labelled 16S rRNA gene amplicons from 1 faecal sample. Each Agilent-030618 array probe (4441) was synthetized in three replicates. Arrays 3 and 4: Hybridization with 250ng of labelled 16S rRNA gene amplicons from 2 faecal samples. Each Agilent-40558 array probe (4441) was synthetized in three replicates.

2013-03-01 | E-GEOD-44752 | biostudies-arrayexpress

A phylogenetic microarray targeting 16S rRNA genes from the bacterial division Acidobacteria

2010-01-01 | GSE18711 | GEO

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

Analysis of microbiota composition within breast tumor and healthy breast tissues in males and females

Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-06-14 | GSE212891 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

Whole rye consumption improves blood and liver n-3 fatty acid profile and gut microbiota composition in rats

Project description:This study in rats was designed to investigate whether whole rhye (WR) can influence the metabolism of n-3 and n-6 long-chain fatty acids (LCFA) and gut microbiota composition. For 12 weeks, rats were fed a diet containing either 50% WR or 50% refined rye (RR). Total bacterial DNA was extracted from fecal and cecal samples (n=5 per group). 16S PCR amplification was performed to assess the microbial diversity at the family level using the HuGChip. Amplified DNA was purified and labelled with either Cy3 or Cy5 dye and hybridized on the microarray. A 15 chip study was realized, each corresponding to hybridization with 250ng of labelled 16S rRNA gene amplicons from either mice fecal and cecal samples. Each probe (4441) was synthetized in three replicates.

2015-08-06 | E-GEOD-71726 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data