Genomic divergence between Plasmodium knowlesi subpopulations
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB23813 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR2214840_1.fastq.gz | Fastqsanger.gz | |||
| ERR2214840_2.fastq.gz | Fastqsanger.gz | |||
| ERR2214850_1.fastq.gz | Fastqsanger.gz | |||
| ERR2214850_2.fastq.gz | Fastqsanger.gz | |||
| ERR2214841_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 42 |
Similar Datasets
Project description:An oligogenic architecture underlying ecological and reproductive divergence in sympatric populations
| PRJEB54033 | ENA
Project description:These data were generated in a study to analyze the genetic causes of gene regulatory divergence. mRNA-seq libraies were prepared from poly(A)+ RNA prepared from whole F1 hybrids of D. melanogaster and D. sechellia (female 0-3d post eclosion, "D_mel_x_D_sec"). A mixed mRNA- seq library was prepared from D. melanogaster and D. sechellia poly(A) + RNA (mixed before library preparation, "D_mel_+_D_sec). Finally, separate mRNA-seq libraries were prepared from poly(A)+ RNA from each species ("D_mel" and "D_sec"). The results of this study showed that 78% of genes expressed in the two species are differentially expressed, and that cis- and trans-regulatory divergence affect 51% and 66% of expressed genes, respectively. Keywords: RNA-Seq
2010-02-20 | GSE20421 | GEO
Project description:Multilocus microsatellite genotyping of Plasmodium knowlesi isolates previously indicated 2 divergent parasite subpopulations in humans on the island of Borneo, each associated with a different macaque reservoir host species. Geographic divergence was also apparent, and independent sequence data have indicated particularly deep divergence between parasites from mainland Southeast Asia and Borneo. To resolve the overall population structure, multilocus microsatellite genotyping was conducted on a new sample of 182 P. knowlesi infections (obtained from 134 humans and 48 wild macaques) from diverse areas of Malaysia, first analyzed separately and then in combination with previous data. All analyses confirmed 2 divergent clusters of human cases in Malaysian Borneo, associated with long-tailed macaques and pig-tailed macaques, and a third cluster in humans and most macaques in peninsular Malaysia. High levels of pairwise divergence between each of these sympatric and allopatric subpopulations have implications for the epidemiology and control of this zoonotic species.
| S-EPMC5367419 | biostudies-literature
Project description:Drosophila Divergence 20091001
| PRJNA118209 | ENA
Project description:Transcription is controlled by the interactions of cis-acting DNA elements with diffusible trans-acting factors. Changes in cis or trans factors can drive expression divergence within and between species, and the relative prevalence of each can reveal the evolutionary path to variation. Previous work delineating the mode of expression divergence in animals has largely used whole body expression measurements in a single condition. Since cis-acting elements often drive expression in a subset of cell types or conditions, these measurements may not capture the complete contribution of cis-acting changes. Here, we quantify the mode of expression divergence in the Drosophila fat body, the primary immune organ, in several conditions. We performed allele-specific expression analysis using two geographically distinct lines of D. melanogaster and their F1 hybrids. We performed separate infections with Gram-negative S. marcescens or Gram-positive E. faecalis bacteria, which trigger the two primary signaling pathways in the Drosophila innate immune response. The mode of expression divergence strongly depends on the condition, with trans-acting effects dominating in response to Gram-positive infection and cis-acting effects dominating in Gram-negative and pre-infection conditions. Expression divergence in several receptor proteins may underlie the infection-specific trans effects. Before infection, when the fat body has a metabolic role, there are many compensatory effects, changes in cis and trans that counteract each other to maintain expression levels. This work demonstrates that within a single tissue, the mode of expression divergence varies between conditions and suggests that these differences reflect the diverse evolutionary histories of host-pathogen interactions.
2021-03-23 | GSE155033 | GEO
Project description:Population genetic analysis revealed that Plasmodium knowlesi infections in Malaysian Borneo are caused by 2 divergent parasites associated with long-tailed (cluster 1) and pig-tailed (cluster 2) macaques. Because the transmission ecology is likely to differ for each macaque species, we developed a simple genotyping PCR to efficiently distinguish between and survey the 2 parasite subpopulations. This assay confirmed differences in the relative proportions in areas of Kapit division of Sarawak state, consistent with multilocus microsatellite analyses. Analyses of 1,204 human infections at Kapit Hospital showed that cluster 1 caused approximately two thirds of cases with no significant temporal changes from 2000 to 2018. We observed an apparent increase in overall numbers in the most recent 2 years studied, driven mainly by increased cluster 1 parasite infections. Continued monitoring of the frequency of different parasite subpopulations and correlation with environmental alterations are necessary to determine whether the epidemiology will change substantially.
| S-EPMC7323547 | biostudies-literature
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO
Project description:Population genomic structure and adaptation in the zoonotic malaria parasite Plasmodium knowlesi.
| PRJEB10288 | ENA
Project description:Astrocytes are one of the most abundant cell types in the mammalian central nervous system. Their diversity was widely investigated in the adult brain recently. However, the heterogeneity of astrocyte progenitors in their early developmental stage is still not clear. In this study, we dissected the subpopulations of neural progenitor cells at the neurogenesis and the early gliogenesis stages by single-cell RNA sequencing analysis. Interestingly, we identified two astrocyte progenitor subgroups from the cerebral cortex. The astrocyte subgroups highly express Sparc or Sparcl1, which were reported have contrary functions in astrocytes to regulate synapse formation. Further analysis for subpopulations of neural progenitors from the ventral forebrain also identified two astrocyte progenitor subgroups, showing similar gene expression patterns as in the cortex. Surprisingly, clustering analysis between the subpopulations from the dorsal and the ventral forebrains showed that the astrocyte progenitors expressing Sparc or Sparcl1 were clustered together, irrespective of their derived regions. These results showed an early divergence of astrocyte progenitors and their cross-regional conservation at the start of gliogenesis during brain development.
2021-12-31 | GSE128948 | GEO