RNA-seq of human glioblastoma cell lines with overexpression of SOX2, SFRP2
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB30789 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR3054720.fastq.gz | Fastqsanger.gz | |||
| ERR3054730.fastq.gz | Fastqsanger.gz | |||
| ERR3054740.fastq.gz | Fastqsanger.gz | |||
| ERR3054750.fastq.gz | Fastqsanger.gz | |||
| ERR3054721.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 36 |
Similar Datasets
Project description:Glioblastomas type A cell line (U-2987) was transfected with pLEX-blast-V5-YFP (control), and pLEX-blast-V5-SFRP2 (SFRP2), and type B cell culture (U-2982, U-343 MG) were transfected with pLEX-blast-V5-YFP (control), and pLEX-blast-V5-SOX2 (SOX2). Then RNA-seq was performed and used to analyse their regulation in the gene expression level.
2021-06-01 | E-MTAB-7591 | biostudies-arrayexpress
Project description:The pluripotency transcription factor SOX2 is essential for the maintenance of glioblastoma stem cells (GSC), which drive tumor growth and treatment resistance.To understand how SOX2 is regulated in GSCs, we utilized a proteomic approach and identified the E3 ubiquitin ligase TRIM26 as a direct SOX2-interacting protein. Unexpectedly, we found TRIM26 depletion decreased SOX2 protein levels and increased SOX2 polyubiquitination in patient-derived GSCs, suggesting TRIM26 promotes SOX2 protein stability. Accordingly, TRIM26 knockdown reduced SOX2 transcriptional activity, self-renewal capacity, and in vivo tumorigenicity in multiple GSC lines. Mechanistically, we found TRIM26, via its C-terminal PRYSPRY domain, but independent of its RING domain, stabilizes SOX2 protein by directly inhibiting the interaction of SOX2 with WWP2, which we identify as a bona fide SOX2 E3 ligase in GSCs. Our work identifies E3 ligase competition as a critical mechanism of SOX2 regulation, with functional consequences for GSC identity and maintenance.
2021-11-04 | PXD028933 | Pride
Project description:Abstract: Prostate cancer bone metastasis is still one of the most fatal cancer diagnosis for men. Survival of the circulating prostate tumor cells and their adaptation strategy to survive in the bone niche is the key point to determining metastasis in early cancer stages. The promoter of SFRP2, a WNT signaling regulator, is hypermethylated in many cancer types including prostate cancer. Moreover, SFRP2 can positively modulate osteogenic differentiation in vitro and in vivo. Here, we showed SFRP2 overexpression in the prostate cancer cell line PC3 induces an epithelial mesenchymal transition (EMT), increases the attachment, and modifies the transcriptome towards an osteoblast-like phenotype (osteomimicry) in a collagen 1‑dependent manner. Our data reflects a novel molecular mechanism how metastasizing prostate cancer cells might increase their chance to survive within bone tissue.
2022-12-16 | GSE217979 | GEO
Project description:Overexpression of the transcription factor SRY-related box 2 (SOX2) is characteristic of Glioblastoma (GBM), yet its regulatory network in vivo is poorly understood. Using a human orthotopic tumor model of GBM for ChIP-Seq analysis, we mapped the SOX2 cistrome. Integrative analysis of SOX2 cistrome and GBM transcriptome data identified two transcription factors, oligodendrocyte lineage transcription factor 2 (OLIG2) and zinc finger E-box binding homeobox 1 (ZEB1) as critical SOX2 targets. Their expression is strongly correlated with SOX2 expression in clinical GBM specimens, and all three proteins are frequently co-expressed in primary Glioblastoma cells, even in the setting of EGFR intratumoral heterogeneity. Sox2, Olig2, and Zeb1 expression is activated by the oncogene EGFRvIII in a murine glioma model, and we demonstrate that co-expression of these transcription factors transforms tumor suppressor deficient astrocytes in the absence of an upstream oncogene and that the resulting tumors exhibit the major histopathological features of GBM.
2017-01-24 | GSE58345 | GEO
Project description:RNA-seq of human glioblastoma cell lines with overexpression of SOX2, SFRP2
2019-04-05 | E-MTAB-7591 | ExpressionAtlas
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.
2014-07-22 | E-GEOD-51441 | biostudies-arrayexpress
Project description:SFRP2 Overexpression Induces an Osteoblast-Like Phenotype in Prostate Cancer Cells
| PRJNA901505 | ENA
Project description:The aim was to identify genes that were influenced by PD-L1 overexpression in glioblastoma cell lines.
2017-12-02 | GSE107581 | GEO
Project description:RNA-seq analysis of PROX1 overexpression and knockdown in glioblastoma cell lines
| PRJEB27945 | ENA
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen).
2014-07-22 | GSE51441 | GEO