Ontology highlight
ABSTRACT:
PROVIDER: PRJEB31487 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| Other | ||||
| ERR3199454_1.fastq.gz | Fastqsanger.gz | |||
| ERR3199454_2.fastq.gz | Fastqsanger.gz | |||
| ERR3199455_1.fastq.gz | Fastqsanger.gz | |||
| ERR3199455_2.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 805 |
Similar Datasets
Project description:We describe a robust linear amplification-mediated high-throughput genome-wide translocation sequencing (HTGTS) method that identifies endogenous or ectopic "prey" DNA double-stranded breaks (DSBs) across the human genome based on their translocation to "bait" DSBs generated by engineered nucleases. HTGTS with different Cas9:gRNA or TALEN-nuclease on-target baits revealed off-target hotspots for given nucleases that ranged from few or none to dozens or more, and greatly extended known off-target numbers for certain previously characterized engineered nucleases by more than 10-fold. Beyond various types of nuclease off-target collateral damage, we also identified collateral damage in the form of translocations between bona fide nuclease targets on homologous chromosomes. Based on frequent non-specific DSBs making any given human chromosome an HTGTS hotspot region for bait DSBs within it, we found that HTGTS also reveals wide-spread, low-level DSB-generating activities of engineered nucleases. Finally, HTGTS confirmed that the Cas9D10A paired nickase approach suppresses off-targets genome-wide and suggested other strategies to enhance desired nuclease activities.
2014-11-29 | GSE57283 | GEO
Project description:RNA-guided nucleases (RGNs) based on CRISPR systems permit installing short and large edits within eukaryotic genomes. However, precise genome editing is often hindered due to nuclease off- target activities and the multiple-copy character of the vast majority of chromosomal sequences. Dual nicking RGNs and high-specificity RGNs both exhibit low off-target activities. Here, we report that high-specificity Cas9 nucleases are convertible into nicking Cas9D10A variants whose precision is superior to that of the commonly used Cas9D10A nickase. Dual nicking RGNs based on a selected group of these Cas9D10A variants can yield gene knockouts and gene knock-ins at frequencies similar to or higher than those achieved by their conventional counterparts. Moreover, high-specificity dual nicking RGNs are capable of distinguishing highly similar sequences by “tiptoeing” over pre-existing single base-pair polymorphisms. Finally, high-specificity RNA-guided nicking complexes generally preserve genomic integrity, as demonstrated by unbiased genome-wide high-throughput sequencing assays. Thus, in addition to substantially enlarging the Cas9 nickase toolkit, we demonstrate the feasibility in expanding the range and precision of genome editing procedures. The herein introduced tools and multi-tier high-specificity genome editing strategies might be particularly beneficial whenever predictability and/or safety of genetic manipulations are paramount.
2020-12-08 | GSE153471 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Because of their smallness, the recently developed CRISPR-Cas12f nucleases can be effectively packaged into adeno-associated viruses for gene therapy. However, a systematic evaluation of the editing outcomes of CRISPR-Cas12f is lacking. In this study, we apply a high-throughput sequencing method to comprehensively assess the editing efficiency, specificity, and safety of four Cas12f proteins in parallel with that of Cas9 and two Cas12a proteins at multiple genomic sites. Cas12f nucleases achieve robust cleavage at most of the tested sites and mainly produce deletional fragments. In contrast, Cas9 and Cas12a show relatively higher editing efficiency at the vast majority of the tested sites. However, the off-target hotspots identified in the Cas9- and Cas12a-edited cells are negligibly detected in the Cas12f-edited cells. Moreover, compared to Cas9 and Cas12a nucleases, Cas12f nucleases reduce the levels of chromosomal translocations, large deletions, and integrated vectors by 2- to 3-fold. Therefore, our findings confirm the editing capacity of Cas12f and reveal the ability of this nuclease family to preserve genome integrity during genome editing.
2022-09-12 | GSE213149 | GEO
Project description:High-fidelity KKH variant of Staphylococcus aureus Cas9 nucleases with improved base mismatch discrimination
| PRJEB51773 | ENA
Project description:Staphylococcus aureus is a gram-positive cocci and an important human commensal bacteria and pathogen. S. aureus infections are increasingly difficult to treat because of the emergence of highly resistant MRSA (Methicillin-resistant S. aureus) strains. Here we present a method to study differential gene expression in S. aureus using high-throughput RNA-sequencing (RNA-seq). We use RNA-seq to examine the differential gene expression in S. aureus RN4220 cells containing an exogenously expressed transcription factor and between two S. aureus strains (RN4220 and NCTC8325-4). The information provided by RNA-seq was a significant advance over previously described microarray based techniques. We investigated the sequence and gene expression differences between RN4220 and NCTC8325-4 and used the RNA-seq data to identify S. aureus promoters suitable for in vitro analysis. We used RNA-seq to describe, on a genome wide scale, genes positively and negatively regulated by a phage encoded transcription factor, gp67. RNA-seq offers the ability to study differential gene expression with single-nucleotide resolution, and is a considerable improvement over the predominant genome-wide transcriptome technologies used in S. aureus. RNA-seq analysis of Staphylococcus aureus RN4220 (electrocompetent strain) carrying either empty pRMC2 (inducible expression vector) or pRMC2 carrying the ORF67 gene (encodes gp67). Both strains were grown to OD 0.2 and transgene expression was induced with 100ng/ml anhydrotetracycline. As a control, Staphylococcus aureus strain NCTC8325-4 (non-electrocompetent strain) was grown under identical conditions except without the addition of anhydrotetracycline.
2013-11-07 | E-GEOD-48896 | biostudies-arrayexpress
Project description:Compilation fo whole genome gene expression changes in Staphylococcus aureus USA300 LAC cultures grown in the presence of vehicle or the anti-gout drug benzbromarone. The drug was intially screened as effective against the agr quorum sensing system in Staphylococcus aureus AH1677. A microarray study using total RNA harvested from three cultures of Staphylococcus aureus USA300 LAC plus vehicle control and three cultures of Staphylococcus aureus USA300 LAC plus 12 uM benzbromarone.
2014-03-19 | E-GEOD-55980 | biostudies-arrayexpress
Project description:Staphylococcus aureus is one of the most important pathogens in humans and animals, multiply resistant strains are increasingly widespread, new agents are needed for the treatment of S. aureus. Rhein, a natural plant product, has potential antimicrobial activity against Staphylococcus aureus. We employed Affymetrix Staphylococcus aureus GeneChipsTM arrays to investigate the global transcriptional profiling of Staphylococcus aureus ATCC25923 treated with rhein. Results provided insight into mechanisms involved in rhein - Staphylococcus aureus interactions. Keywords: rhein response
2007-06-15 | GSE8135 | GEO
Project description:Compilation fo whole genome gene expression changes in Staphylococcus aureus USA300 LAC cultures grown in the presence of vehicle or the anti-gout drug benzbromarone. The drug was intially screened as effective against the agr quorum sensing system in Staphylococcus aureus AH1677.
2014-03-19 | GSE55980 | GEO