DeepMalaspina16S
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB45011 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Amplicon 18S rRNA Illumina TAGs from Malaspina Bathypelagic samples
| PRJEB45014 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Nitrate-reducing iron(II)-oxidizing (NDFO) bacteria are widespread in the environment contribute to nitrate removal and influence the fate of the greenhouse gases nitrous oxide and carbon dioxide. The autotrophic growth of nitrate-reducing iron(II)-oxidizing bacteria is rarely investigated and poorly understood. The most prominent model system for this type of studies is enrichment culture KS, which originates from a freshwater sediment in Bremen, Germany. A second NDFO culture, culture BP, was obtained with a sample taken in 2015 at the same pond and cultured in a similar way. To gain insights in the metabolism of nitrate reduction coupled to iron(II) oxidation under in the absence of organic carbon and oxygen limited conditions, we performed metagenomic, metatranscriptomic and metaproteomic analyses of culture BP. Raw sequencing data of 16S rRNA amplicon sequencing (V4 region with Illumina and near full-length with PacBio), shotgun metagenomics, metagenome assembly, raw sequencing data of shotgun metatranscriptomes (2 conditions, triplicates) can be found at SRA in https://www.ncbi.nlm.nih.gov/bioproject/PRJNA693457. This dataset contains proteomics data for 2 conditions in triplicates. Samples R23, R24, and R25 are grown in autotrophic conditions, samples R26, R27, and R28 in heterotrophic conditions.
2021-05-17 | PXD023710 | Pride
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.
2016-01-01 | GSE73842 | GEO
Project description:Nitrate-reducing iron(II)-oxidizing bacteria are widespread in the environment contribute to nitrate removal and influence the fate of the greenhouse gases nitrous oxide and carbon dioxide. The autotrophic growth of nitrate-reducing iron(II)-oxidizing bacteria is rarely investigated and poorly understood. The most prominent model system for this type of studies is enrichment culture KS, which originates from a freshwater sediment in Bremen, Germany. To gain insights in the metabolism of nitrate reduction coupled to iron(II) oxidation under in the absence of organic carbon and oxygen limited conditions, we performed metagenomic, metatranscriptomic and metaproteomic analyses of culture KS. Raw sequencing data of 16S rRNA amplicon sequencing, shotgun metagenomics (short reads: Illumina; long reads: Oxford Nanopore Technologies), metagenome assembly, raw sequencing data of shotgun metatranscriptomes (2 conditions, triplicates) can be found at SRA in https://www.ncbi.nlm.nih.gov/bioproject/PRJNA682552. This dataset contains proteomics data for 2 conditions (heterotrophic and autotrophic growth conditions) in triplicates.
2021-05-17 | PXD023186 | Pride
Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.
2024-03-01 | GSE254843 | GEO
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride