Fecal Microbiota of Healthy Alpacas
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB49225 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| Other | ||||
| ERR9609130.fastq.gz | Fastqsanger.gz | |||
| ERR9609131.fastq.gz | Fastqsanger.gz | |||
| ERR9609132.fastq.gz | Fastqsanger.gz | |||
| ERR9609129.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 306 |
Similar Datasets
Project description:This study aimed to analyze changes in gut microbiota composition in mice after transplantation of fecal microbiota (FMT, N = 6) from the feces of NSCLC patients by analyzing fecal content using 16S rRNA sequencing, 10 days after transplantation. Specific-pathogen-free (SPF) mice were used for each experiments (N=4) as controls.
2023-07-01 | E-MTAB-12812 | biostudies-arrayexpress
Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.
2024-03-01 | GSE254843 | GEO
Project description:Interventions: An observational study at the Dutch Screening for Breast Cancer will be performed in 66 postmenopausal women without breast cancer. By acquiring insight into the intestinal microbiota composition of postmenopausal women without breast cancer, a control group will be set up for already existing research lines in microbiota research in breast cancer patients at MUMC+. Fecal samples and questionnaires will be collected. The intestinal microbiota composition and absolute abundance of the fecal samples will be analyzed by with 16S rRNA Next Generation Sequencing (NGS) with subsequent qPCR to convert relative abundance to absolute abundance.
Primary outcome(s): The primary endpoints include the microbiota composition.
Study Design: N/A , unknown, Other
| 21684 | ecrin-mdr-crc
Project description:The aim of this study was to test the hypothesis that replenishing the microbiota with a fecal microbiota transplant (FMT) can rescue a host from an advanced stage of sepsis. We developed a clinically-relevant mouse model of lethal polymicrobial gut-derived sepsis in mice using a 4-member pathogen community (Candida albicans, Klebsiella oxytoca, Serratia marcescens, Enterococcus faecalis) isolated from a critically ill patient. In order to mimic pre-operative surgical patient condition mice were exposed to food restriction and antibiotics. Approximately 18 hours prior to surgery food was removed from the cages and the mice were allowed only tap water. Each mouse received an intramuscular Cefoxitin injection 30 minutes prior to the incision at a concentration of 25 mg/kg into the left thigh. Mice were then subjected to a midline laparotomy, 30% hepatectomy of the left lateral lobe of the liver and a direct cecal inoculation of 200 µL of the four pathogen community. On postoperative day one, the mice were administered rectal enema. Mice were given either 1 ml of fecal microbiota transplant (FMT) or an autoclaved control (AC). This was again repeated on postoperative day two. Mice were then followed for mortality. Chow was restored to the cages on postoperative day two, approximately 45 hours after the operation. The injection of fecal microbiota transplant by enema significantly protected mice survival, reversed the composition of gut microflora and down-regulated the host inflammatory response. The cecum, left lobe of the liver, and spleen were isolated from mice for microarray processing with three or more replicates for six expermental conditions: non-treated control, SAHC POD1, SAHC.AC POD2, SAHC.FMT POD2, SAHC.AC POD7, SAHC.FMT POD7
2015-07-30 | E-GEOD-71530 | biostudies-arrayexpress
Project description:Complex oligosaccharides found in human milk play a vital role in gut microbiome development for the human infant. Bovine milk oligosaccharides (BMO) have similar structures with those derived from human milk, but have not been well studied for their effects on the healthy adult human gut microbiome. Healthy human subjects consumed BMO over two-week periods at two different doses and provided fecal samples. Metatranscriptomics of fecal samples was conducted to determine microbial and host gene expression in response to the supplement. Fecal samples were also analyzed by mass spectrometry to determine levels of undigested BMO. No changes were observed in microbiome activity across all participants. Repeated sampling enabled subject-specific analyses: four of six participants had minor, yet statistically significant, changes in microbial activity. No significant change was observed in the gene expression of host cells in stool. Levels of BMO excreted in feces after supplementation were not significantly different from placebo and were not correlated with dosage or expressed microbial enzyme levels. Collectively, these data suggest that BMO is fully digested in the human gastrointestinal tract prior to stool collection. Participants’ gut microbiomes remained stable but varied between individuals. Additionally, the unaltered host transcriptome provides further evidence for the safety of BMO as a dietary supplement or food ingredient.
2020-02-18 | GSE108809 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:We aimed to investigate the microbial community composition in patients with intracerebral hemorrhage (ICH) and its effect on prognosis. The relationship between changes in bacterial flora and the prognosis of spontaneous cerebral hemorrhage was studied in two cohort studies. Fecal samples from healthy volunteers and patients with intracerebral hemorrhage were subjected to 16S rRNA sequencing at three time points: T1 (within 24 hours of admission), T2 (3 days post-surgery), and T3 (7 days post-surgery) using Illumina high-throughput sequencing technology.
2024-08-22 | E-MTAB-14351 | biostudies-arrayexpress
Project description:Fecal samples collected on day 5 from randomly selected colitic SD rats were analyzed for gut microbiota by sequencing the V4 region of the 16S rRNA gene. The orally administered Dex-P-laden NPA2 coacervate (Dex-P/NPA2) significantly restores the diversity of gut microbiota compared with colitic SD rats in the Dex-P/PBS group and the untreated colitic rats (Control).
2021-11-06 | GSE167138 | GEO
Project description:The aim of this study was to test the hypothesis that replenishing the microbiota with a fecal microbiota transplant (FMT) can rescue a host from an advanced stage of sepsis. We developed a clinically-relevant mouse model of lethal polymicrobial gut-derived sepsis in mice using a 4-member pathogen community (Candida albicans, Klebsiella oxytoca, Serratia marcescens, Enterococcus faecalis) isolated from a critically ill patient. In order to mimic pre-operative surgical patient condition mice were exposed to food restriction and antibiotics. Approximately 18 hours prior to surgery food was removed from the cages and the mice were allowed only tap water. Each mouse received an intramuscular Cefoxitin injection 30 minutes prior to the incision at a concentration of 25 mg/kg into the left thigh. Mice were then subjected to a midline laparotomy, 30% hepatectomy of the left lateral lobe of the liver and a direct cecal inoculation of 200 µL of the four pathogen community. On postoperative day one, the mice were administered rectal enema. Mice were given either 1 ml of fecal microbiota transplant (FMT) or an autoclaved control (AC). This was again repeated on postoperative day two. Mice were then followed for mortality. Chow was restored to the cages on postoperative day two, approximately 45 hours after the operation. The injection of fecal microbiota transplant by enema significantly protected mice survival, reversed the composition of gut microflora and down-regulated the host inflammatory response.
2015-07-30 | GSE71530 | GEO
Project description:ASSESSMENT OF THE FECAL MICROBIOME IN HEALTHY VOLUNTEERS AND IRRITABLE BOWEL SYNDROME PATIENTS
| PRJNA524547 | ENA