Anti-CRISPR Anopheles mosquitoes inhibit gene drive spread under challenging behavioural conditions in large cages
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB61434 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Anti-CRISPR Anopheles mosquitoes inhibit gene drive spread under challenging behavioural conditions in large cages
| PRJEB71097 | ENA
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:Overall, the study aims at obtaining a comprehensive picture of the African malaria mosquito, Anopheles gambiae, transcriptome using high-coverage RNA-seq of sexed whole-insect samples collected at different developmental time points. This experiment focuses on transcriptomes of 1st, 2nd, 3rd and 4th instar male and female larvae, and 2 day old male and female adults.
2015-04-01 | E-MTAB-2527 | biostudies-arrayexpress
Project description:Malaria mosquitoes acoustically detect their mating partners within large swarms that form transiently at dusk. Indeed, male malaria mosquitoes preferably respond to female flight tones during swarm time. This phenomenon implies a sophisticated context- and time-dependent modulation of mosquito audition, the mechanisms of which are largely unknown. Using transcriptomics, we identify a complex network of candidate neuromodulators regulating mosquito hearing in the species Anopheles gambiae. Among them, octopamine stands out as auditory modulator during swarm time. In-depth analysis of octopamine auditory function shows that it affects the mosquito ear on multiple levels: it modulates the tuning and stiffness of the flagellar sound receiver and controls the erection of antennal fibrillae. We show that two α- and β-adrenergic-like octopamine receptors drive octopamine’s auditory roles and demonstrate that the octopaminergic auditory control system can be targeted by insecticides. Our findings highlight octopamine as key for mosquito hearing and mating partner detection, and as a potential novel target for mosquito control.
2023-07-05 | GSE235286 | GEO
Project description:We conducted a genome wide survey of mosquito gene expression profiles in 4 different tissues of adult Anopheles gambiae mosquitoes. The tissues included the head, the midgut, the carcass (corresponding to the remainder of the mosquito after decapitation and midgut removal) and ovaries. Ovaries were collected from adult female mosquitoes, which had been bloodfed 48h prior to dissection. To investigate mosquito expression in those tissues, we performed competitive two-dye hybridizations of experimental and standard reference RNA samples to MMC1 microarrays. MMC1 microarrays contain approximately 20,000 EST clones. Standard reference RNA was produced in vitro from the spotted ESTs and was utilized to provide consistent, non-zero reference values for almost all probes of the array. For the experiment, two biological replicates, corresponding to mosquito generations 1 and 3 (generation 2 was discarded due to probable labelling errors) and one technical (dye-swap) replicate was conducted.
2007-07-19 | E-TABM-153 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Overall, the study aims at obtaining a comprehensive picture of the African malaria mosquito, Anopheles gambiae, transcriptome using high-coverage RNA-seq of sexed whole-insect samples collected at different developmental time points. This experiment focuses on male and female transcriptomes from 4th instar larvae at 12 and 36 hours, and 10 day and 20 day adult mosquitoes. Three biological replicates per sex are included for the 4th instar 12 hour transcriptomes. A single female embryonic 20 hour transcriptome is also included, which is paired with a male transcriptome from the same 20h embryonic timepoint within accession number E-MTAB-2583.
2015-04-01 | E-MTAB-2665 | biostudies-arrayexpress
Project description:We compare the transcriptome of gnotobiotic Ae. aegypti generated by contaminating axenic (bacteria-free) larvae with bacterial isolates found in natural mosquito breeding sites. We focused on four bacterial isolates (Lysobacter, Flavobacterium, Paenibacillus and Enterobacteriaceae) and found that different gnotobiotic treatments resulted in massive transcriptomic changes throughout the mosquito development.
2021-12-15 | GSE173472 | GEO
Project description:Background: The mosquito Anopheles gambiae is a major vector of human malaria. Increasing evidence indicates that blood cells (hemocytes) comprise an essential arm of the mosquito innate immune response against both bacteria and malaria parasites. To further characterize the role of hemocytes in mosquito immunity, we undertook the first genome-wide transcriptomic analyses of adult female An. gambiae hemocytes following infection by two species of bacteria and a malaria parasite. Results: We identified 4047 genes expressed in hemocytes, using An. gambiae genome-wide microarrays. While 279 transcripts were significantly enriched in hemocytes relative to whole adult female mosquitoes, 959 transcripts exhibited immune challenge-related regulation. The global transcriptomic responses of hemocytes to challenge with different species of bacteria and/or different stages of malaria parasite infection revealed discrete, minimally overlapping, pathogen-specific signatures of infection-responsive gene expression; 105 of these represented putative immunity-related genes including anti-Plasmodium factors. Of particular interest was the specific co-regulation of various members of the Imd and JNK immune signaling pathways during malaria parasite invasion of the mosquito midgut epithelium. Conclusion: Our genome-wide transcriptomic analysis of adult mosquito hemocytes reveals pathogen-specific signatures of gene regulation and identifies several novel candidate genes for future functional studies.
2011-10-31 | GSE33269 | GEO
Project description:Proteomic analysis of Anopheles gambiae brain tissue after in-gel trypsin digestion. To gain insights into neurobiology of the Anopheles gambiae mosquito, we carried out a proteomic analysis of its brain using a comprehensive proteomic approach.
2016-12-20 | PXD000630 | Pride