Project description:A wide diversity of pathogenic mosquito-borne viruses circulate in the Brazilian Amazon, and the intense deforestation can contribute to the spread of these viruses. In this context, this study aimed to investigate the viral diversity in mosquitoes of the genera Aedes, Culex, Haemagogus, and Sabethes from a transition area between the Amazon, Cerrado, and Caatinga biomes in Brazil. Metagenomic high-throughput sequencing was used to characterize the virome of 20 mosquito pools. A total of 15 virus-like genomes were identified, comprising species genomically close to insect-specific viruses of the families Iflaviridae, Metaviridae, Lispiviridae, Rhabdoviridae, Xinmoviridae, and Parvoviridae and species of plant viruses of the families Solemoviridae, Virgaviridae, and Partitiviridae. However, sequences of viruses associated with human and animal diseases were not detected. Most of the recovered genomes were divergent from those previously described. These findings reveal that there are a large number of unknown viruses to be explored in the middle-north of Brazil.
Project description:The genes had different expression between healthy people and acute myocardial infarction.We aimed to identify the differentially expressed genes involved in acute myocardial infarction in Northeast Chinese Han people. We used microarrays to detail the global programme of gene expression to identify the differentially gene between the patients with acute myocardial infarction and healthy people in Northeast Chinese Han people
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.