Tracking arboviruses, their transmission vectors and potential hosts by nanopore sequencing of mosquitoes
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB67345 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR12180600.fastq.gz | Fastqsanger.gz | |||
| ERR12180700.fastq.gz | Fastqsanger.gz | |||
| ERR12180601.fastq.gz | Fastqsanger.gz | |||
| ERR12180701.fastq.gz | Fastqsanger.gz | |||
| ERR12180602.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 130 |
Similar Datasets
Project description:The risk to human health from mosquito-borne viruses such as dengue, chikungunya and yellow fever is increasing due to increased human expansion, deforestation and climate change. To anticipate and predict the spread and transmission of mosquito-borne viruses, a better understanding of the transmission cycle in mosquito populations is needed. We present a pathogen-agnostic combined sequencing protocol for identifying vectors, viral pathogens and their hosts or reservoirs using portable Oxford Nanopore sequencing. Using mosquitoes collected in São Paulo, Brazil, we extracted RNA for virus identification and DNA for blood meal and mosquito identification. Mosquitoes and blood meals were identified by comparing cytochrome c oxidase I (COI) sequences against a curated Barcode of Life Data System (BOLD). Viruses were identified using the SMART-9N protocol, which allows amplified DNA to be prepared with native barcoding for nanopore sequencing. Kraken 2 was employed to detect viral pathogens and Minimap2 and BOLD identified the contents of the blood meal. Due to the high similarity of some species, mosquito identification was conducted using blast after generation of consensus COI sequences using RACON polishing. This protocol can simultaneously uncover viral diversity, mosquito species and mosquito feeding habits. It also has the potential to increase understanding of mosquito genetic diversity and transmission dynamics of zoonotic mosquito-borne viruses.
| S-EPMC10868619 | biostudies-literature
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:The model prokaryote Escherichia coli can exist as a either a commensal or a pathogen in the gut of diverse mammalian hosts. These associations, coupled with its ease of cultivation and genetic variability, have made E. coli a popular indicator organism for tracking the origin of fecal water contamination. Source tracking accuracy is predicated on the assumption that E. coli isolates recovered from contaminated water present a genetic signature characteristic of the host from which they originated. In this study, we compared the accuracy with which E. coli isolated from humans, bear, cattle and deer could be identified by standard fingerprinting methods used for library-based microbial source tracking (repetitive element PCR and pulsed-field gel electrophoresis) in relation to microarray-based analysis of genome content. Our results show that patterns of gene presence or absence were more useful for distinguishing E. coli isolates from different sources than traditional fingerprinting methods, particularly in the case of human strains. Host-associated differences in genome composition included the presence or absence of mobile IS1 elements as well as genes encoding the ferric dicitrate iron transporter (fec), E. coli common pilus (ECP), type 1 fimbriae and the CRISPR associated cas proteins. Many of these differences occurred in regions of the E. coli chromosome previously shown to be M-bM-^@M-^\hot spotsM-bM-^@M-^] for the integration of horizontally-acquired DNA. PCR primers designed to amplify the IS1 and fec loci confirmed array results and demonstrated the ease with which gene presence/absence data can be converted into a diagnostic assay. The data presented here suggest that, despite the high level of genetic diversity observed among isolates by PFGE, human-derived strains may constitute a distinct ecotype distinguished by multiple potential library-independent source tracking markers. Twelve isolates of E. coli ( 3 from bear, 3 from cattle, 3 from deer and 3 from humans) were isolated from feces and/or raw sewage. Genome content for each strain was assessed in duplicate using comparative genome hybridization with E. coli K12 MG1655 as the reference for a total of 24 arrays.
2013-03-01 | E-GEOD-21115 | biostudies-arrayexpress
Project description:Determination of miRNA profiles in most prominent mosquitoes will determine the potential targets for mosquito control Some of the most medically important viruses, such as dengue virus, West Nile virus, Zika virus, and yellow fever virus, are transmitted by mosquitoes. These aptly named arboviruses impose a tremendous cost to the health of populations around the world. As a result, much effort has gone into the study of the impact of these viruses in human infections. Comparatively less efforts, however, have been made to study the way these viruses interact with mosquitos themselves. It has long been held that these viruses are introduced into the midgut of mosquitoes upon ingestion of a blood meal before being transmitted within the saliva upon subsequent feeding. This sequence requires that the mosquito be able to defend itself from infection every step along the way-from ingesting bloodmeal to subsequent feeding. The main defense mechanisms employed by the mosquitoes to control viruses is RNA interference (RNAi). Modulation of this facet of the mosquito’s immune system would thereby suggest a practical strategy for vector control. This paper will provide an up to date overview of the mosquito’s immune system along with novel data describing miRNA profiles for Aedes aegypti and Culex quinquefasiatus in Grenada, West Indies.
2020-04-29 | GSE149518 | GEO
Project description:The model prokaryote Escherichia coli can exist as a either a commensal or a pathogen in the gut of diverse mammalian hosts. These associations, coupled with its ease of cultivation and genetic variability, have made E. coli a popular indicator organism for tracking the origin of fecal water contamination. Source tracking accuracy is predicated on the assumption that E. coli isolates recovered from contaminated water present a genetic signature characteristic of the host from which they originated. In this study, we compared the accuracy with which E. coli isolated from humans, bear, cattle and deer could be identified by standard fingerprinting methods used for library-based microbial source tracking (repetitive element PCR and pulsed-field gel electrophoresis) in relation to microarray-based analysis of genome content. Our results show that patterns of gene presence or absence were more useful for distinguishing E. coli isolates from different sources than traditional fingerprinting methods, particularly in the case of human strains. Host-associated differences in genome composition included the presence or absence of mobile IS1 elements as well as genes encoding the ferric dicitrate iron transporter (fec), E. coli common pilus (ECP), type 1 fimbriae and the CRISPR associated cas proteins. Many of these differences occurred in regions of the E. coli chromosome previously shown to be “hot spots” for the integration of horizontally-acquired DNA. PCR primers designed to amplify the IS1 and fec loci confirmed array results and demonstrated the ease with which gene presence/absence data can be converted into a diagnostic assay. The data presented here suggest that, despite the high level of genetic diversity observed among isolates by PFGE, human-derived strains may constitute a distinct ecotype distinguished by multiple potential library-independent source tracking markers.
2013-03-01 | GSE21115 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:The impact of global climate change on the transmission dynamics of infectious diseases is the subject of extensive debate. The transmission of mosquito-borne viral diseases is particularly complex, with climatic variables directly affecting many parameters associated with the prevalence of disease vectors. While evidence shows that warmer temperatures often decrease the extrinsic incubation period of an arthropod-borne virus (arbovirus), exposure to cooler temperatures often predisposes disease vector mosquitoes to higher infection rates. RNA interference pathways are essential to antiviral immunity in the mosquito; however, few experiments have explored the effects of temperature on the RNAi machinery. Total small RNAs (miRNAs, siRNAs, piRNAs, etc.) were isolated and sequenced from the heads of sensor strain Aedes aegypti mosquitoes, or from the whole bodies of CHIKV-infected Aedes albopictus mosquitoes 8 hours post infection. Mosquitoes were grown at 18C or 28C in replicates of 1 (Ae. aegypti) or 3 (Ae. albopictus).
2013-08-13 | E-GEOD-46204 | biostudies-arrayexpress
Project description:Wolbachia pipientis strain:mosquitoes | isolate:mosquitoes Genome sequencing
| PRJNA524640 | ENA
Project description:Source-tracking fecal contamination by genomic analysis of Escherichia coli from human and animal hosts
| PRJNA126467 | ENA