Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach. Phylogenetic study of the Treponema taxa found in digital dermatitis lesions of Holstein cows.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Prostate of SD rats was injected with 0.1 ml 1% carrageenan to induce chronic nonbacterial prostatitis, and the control rats injected with sterile saline. Then, the cecal contents were collected for 16S rDNA sequencing.
Project description:The use of microbiological cultures for diagnosing bacterial infections in young febrile infants have substantial limitations, including false positive and false negative cultures, and non-ideal turn-around times. Analysis of host genomic expression patterns (âRNA biosignaturesâ) in response to the presence of specific pathogens, however, may provide an alternate and potentially improved diagnostic approach. This study was designed to define bacterial and non-bacterial RNA biosignatures to distinguish these infections in young febrile infants. A total of 279 febrile infants and 19 healthy afebrile control infants aged 0-6 months (for a total of 298 samples) for microarray analysis. For analytic purposes, we classified patients into two groups, those with bacterial infections (n=89) and those with non-bacterial infections (n=190). 144 of the samples were run on Illumina HT12 V4 R1 chips. Of these, there were 34 bacterial infections, 105 non-bacterial infections, and 5 healthy afebrile controls. 154 of the samples were run on Illumina HT12 V4 R2 chips. Of these, there were 55 bacterial infections, 85 non-bacterial infections, and 14 healthy afebrile controls.