Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Amplicon Sequencing of gRNAs from Brunello CRISPR mutagenized HT29-DKO cells after live/dead selection with PeV-A1 and PeV-A2

ABSTRACT: Amplicon Sequencing of gRNAs from Brunello CRISPR mutagenized HT29-DKO cells after live/dead selection with PeV-A1 and PeV-A2

PROVIDER: PRJEB73612 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Similar Datasets

Amplicon Sequencing of gRNAs from Brunello CRISPR mutagenized HT29-DKO cells after live/dead selection with PeV-A1 and PeV-A2

Project description:HT29-DKO cells were stably transduced with lentiCas9-Blast (Addgene, #52962) and subsequently selected using Blasticidin. Then, 300 million HT29-DKO cells that constitutively express Cas9 were transduced with lentiGuide-Puro from the Brunello library at MOI 0.3. Cells were then selected with puromycin, expanded to 3 billion cells, and then pooled together and cryofrozen in aliquots. One hundred million cells were thawed constituting over 1000× genome coverage worth of mutagenized library. The cells were infecting with PeV-A1 or PeV-A2 at an MOI of 0.1. Virus-resistant colonies were harvested. The uninfected reference used was the unselected starting population. The unselected and selected cells were both processed with QIAamp DNA columns to purify the gDNA. A first round of PCR was used to amplify the guide RNA sequences encoded in the gDNA, followed by a second round of PCR to add the barcodes/adapters for amplicon sequencing. 2% agarose gels and a QIAquick gel extraction kit were used to purify the amplicons. The amplicons were then subjected to next-generation sequencing on a HiSeq instrument lane (Illumina) via Novogene.

2024-03-16 | E-MTAB-13894 | biostudies-arrayexpress

Amplicon Sequencing of gRNAs from Brunello CRISPR mutagenized U87MG or eHAP cells after live/dead selection with Reovirus Type 3 Dearing Strain.

Project description:eHAP or U87MG cells were stably transduced with lentiCas9-Blast (Addgene, #52962) and subsequently selected using Blasticidin. Then, 300 million eHAP or U87MG cells that constitutively express Cas9 were transduced with lentiGuide-Puro from the Brunello library at MOI 0.3. Cells were then selected with puromycin, expanded to 3 billion cells, and then pooled together and cryofrozen in aliquots. One hundred million cells were thawed constituting over 1000× genome coverage worth of mutagenized library. Twenty T175 flasks were used for the U87MG-based screen, while twelve T175 flasks were used for the eHAP-based screen. The cells were allowed to recover for 48 hours before infecting with ReoT3D at an MOI of 0.1. Obvious CPE was observed within 72 hours. eHAP-resistant colonies were harvested two weeks later, while U87MG-resistant colonies were harvested six weeks later. The uninfected reference used was the unselected starting population. The unselected and selected cells were both processed with QIAamp DNA columns to purify the gDNA. A first round of PCR was used to amplify the guide RNA sequences encoded in the gDNA, followed by a second round of PCR to add the barcodes/adapters for amplicon sequencing. 2% agarose gels and a QIAquick gel extraction kit were used to purify the amplicons. The amplicons were then subjected to next-generation sequencing on a HiSeq instrument lane (Illumina) via Novogene.

2022-09-10 | E-MTAB-11158 | biostudies-arrayexpress

Amplicon Sequencing of gRNAs from Brunello CRISPR mutagenized U87MG or eHAP cells after live/dead selection with Reovirus Type 3 Dearing Strain.

Project description:Amplicon Sequencing of gRNAs from Brunello CRISPR mutagenized U87MG or eHAP cells after live/dead selection with Reovirus Type 3 Dearing Strain.

| PRJEB48856 | ENA

HT29 and GATA6

Project description:HT29 and GATA6

| PRJNA263819 | ENA

Expression data from shROR HT29 and AGS cell

2015-06-05 | GSE67416 | GEO

Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER [CRISPR]

Project description:Recent technological developments in single-cell RNA-seq CRISPR screens enable high-throughput investigation of the genome. Through transduction of a gRNA library to a cell population followed by transcriptomic profiling by scRNA-seq, it is possible to characterize the effects of thousands of genomic perturbations on global gene expression. A major source of noise in scRNA-seq CRISPR screens are ambient gRNAs, which are contaminating gRNAs that likely originate from other cells. If not properly filtered, ambient gRNAs can result in an excess of false positive gRNA assignments. Here, we utilize CRISPR barnyard assays to characterize ambient gRNA noise in single-cell CRISPR screens. We use these datasets to develop and train CLEANSER, a mixture model that identifies and filters ambient gRNA noise. This model takes advantage of the bimodal distribution between native and ambient gRNAs and includes both gRNA and cell-specific normalization parameters, correcting for confounding technical factors that affect individual gRNAs and cells. The output of CLEANSER is the probability that a gRNA-cell assignment is in the native distribution over the ambient distribution. We find that ambient gRNA filtering methods impact differential gene expression analysis outcomes and that CLEANSER outperforms alternate approaches by increasing gRNA-cell assignment accuracy.

2024-10-08 | GSE272454 | GEO

Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER [scRNA-seq]

2024-10-08 | GSE272457 | GEO

Expression data from shROR HT29 and AGS cell

Project description:Genome-wide cDNA array from HT29,HT29-shROR,HT29-Mock, AGS, AGS-shROR, AGS-Mock cells We used microarrays to detail the global programme of gene expression and identified significantly changed genes after ROR depletion. HT29,HT29-shROR, HT29-Mock, AGS, AGS-shROR, AGS-Mock cells were selected for RNA extraction and hybridization on Affymetrix microarrays.

2015-06-05 | E-GEOD-67416 | biostudies-arrayexpress

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

2024-08-27 | GSE225822 | GEO

RNA sequencing on HT29 colorectal cancer cell line

Project description:We report the single cell RNA sequencing on HT29 colorectal cancer line with 100 nM dasatinib treatment after double thymidine block.

2020-09-30 | GSE128416 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data