Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1000755 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Sulfur metabolism in the deep-sea cold seep has been mentioned to have an important contribution to the biogeochemical cycle of sulfur in previous studies. And sulfate reducing bacteria have also been considered to be a dominant microbial population in the deep-sea cold seep and play a crucial role in this process. However, most of sulfate reducing bacteria from cold seep still cannot be purely cultured under laboratory conditions, therefore the actual sulfur metabolism pathways in sulfate reducing bacteria from the deep-sea cold seep have remained unclear. Here, we isolate and pure culture a typical sulfate reducing bacterium Desulfovibrio marinus CS1 from the sediment sample of the deep-sea cold seep in the South China Sea, which provides a probability to understand the sulfur metabolism in the cold seep.
2024-06-16 | PXD023247 | Pride
Project description:Zero-valent sulfur (ZVS) distributes widely in the deep-sea cold seep, which is important immediate in the active sulfur cycle of cold seep. In our preview work, a novel ZVS formation pathway discovered in the deep-sea cold weep bacterium Erythrobacter flavus 21-3 was described. However, whether this pathway worked and what function roles it played in the cold seep were unknown. In this study, E. flavus 21-3 was verified to produce zero-valent sulfur in the cold seep using genes soxB and tsdA as our preview report described. Based on proteomic data, stoichiometric methods and microscopic observation, this ZVS formation pathway benefited E. flavus 21-3 in the deep-sea cold seep. Notably, 30% metagenomes contained these two genes in the shallow sediments, which present the most abundant sulfur genes and active sulfur cycle in the cold seep sediments. It suggested that this sulfur formation pathway exist across many bacteria in the cold seep. This strongly indicates that this novel pathway might be frequently used by microbes and plays an important role in the biogeochemical sulfur cycle in cold seep.
2022-07-09 | PXD029383 | Pride
Project description:The deep marine subsurface is one of the largest unexplored biospheres on Earth, where members of the phylum Chloroflexi are abundant and globally distributed. However, the deep-sea Chloroflexi have remained elusive to cultivation, hampering a more thorough understanding of their metabolisms. In this work, we have successfully isolated a representative of the phylum Chloroflexi, designated strain ZRK33, from deep-sea cold seep sediments. Phylogenetic analyses based on 16S rRNA genes, genomes, RpoB and EF-tu proteins indicated that strain ZRK33 represents a novel class within the phylum Chloroflexi, designated Sulfochloroflexia. We present a detailed description of the phenotypic traits, complete genome sequence and central metabolisms of the novel strain ZRK33. Notably, sulfate and thiosulfate could significantly promote the growth of the new isolate, possibly through accelerating the hydrolysis and uptake of saccharides. Thus, this result reveals that strain ZRK33 may play a crucial part in sulfur cycling in the deep-sea environments. Moreover, the putative genes associated with assimilatory and dissimilatory sulfate reduction are broadly distributed in the genomes of 27 metagenome-assembled genomes (MAGs) from deep-sea cold seep and hydrothermal vents sediments. Together, we propose that the deep marine subsurface Chloroflexi play key roles in sulfur cycling for the first time. This may concomitantly suggest an unsuspected availability of sulfur-containing compounds to allow for the high abundance of Chloroflexi in the deep sea.
2024-05-22 | PXD023380 | Pride
Project description:Haima cold seep microbial communities Raw sequence reads
| PRJNA1097764 | ENA
Project description:Cold seep sediments Metagenomic sequence
| PRJNA1003025 | ENA
Project description:To effectively monitor microbial populations in acidic environments and bioleaching systems, a comprehensive 50-mer-based oligonucleotide microarray was developed based on most of the known genes associated with the acidophiles. This array contained 1,072 probes in which there were 571 related to 16S rRNA and 501 related to functional genes. Acid mine drainage (AMD) presents numerous problems to the aquatic life and surrounding ecosystems. However, little is known about the geographic distribution, diversity, composition, structure and function of AMD microbial communities. In this study, we analyzed the geographic distribution of AMD microbial communities from twenty sites using restriction fragment length polymorphism (RFLP) analysis of 16S rRNA genes, and the results showed that AMD microbial communities were geographically distributed and had high variations among different sites. Then an AMD-specific microarray was used to further analyze nine AMD microbial communities, and showed that those nine AMD microbial communities had high variations measured by the number of detected genes, overlapping genes between samples, unique genes, and diversity indices. Statistical analyses indicated that the concentrations of Fe, S, Ca, Mg, Zn, Cu and pH had strong impacts on both phylogenetic and functional diversity, composition, and structure of AMD microbial communities. This study provides insights into our understanding of the geographic distribution, diversity, composition, structure and functional potential of AMD microbial communities and key environmental factors shaping them. This study investigated the geographic distribution of Acid Mine Drainages microbial communities using a 16S rRNA gene-based RFLP method and the diversity, composition and structure of AMD microbial communities phylogenetically and functionally using an AMD-specific microarray which contained 1,072 probes ( 571 related to 16S rRNA and 501 related to functional genes). The functional genes in the microarray were involved in carbon metabolism (158), nitrogen metabolism (72), sulfur metabolism (39), iron metabolism (68), DNA replication and repair (97), metal-resistance (27), membrane-relate gene (16), transposon (13) and IST sequence (11).
2011-03-08 | E-GEOD-27542 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO