Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.
Project description:Purpose:To investigate the transcriptomic profiles in zebrafish embryos exposed externally to nucleotides at a critical develpomental window (3-7 days post fertilization) determine biological processes and pathways based on differentially expressed gene transcripts using High Throughput Sequencing (HTS). Methods:Total mRNA profiles of 7 dpf zebraifsh embryos after exposure to 10-5M ATP, AMP, adenosine and adenine were generated by deep sequencing, in triplicate, using Illumina HiSeq2500 Results: There were many differentially expressed genes; including ubiquitin-, actin-, and tubulin-related, showing that the cytoskeleton was altered; other DEGs involved with purine binding, specifically guanine, which was expected as the mixture was composed of purines; DEGs involved with GTP binding were also upregulated, suggesting increased cell signaling,
