Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

High throughput sequencing of fungal soil samples from volcanic and non volcanic areas

ABSTRACT: High throughput sequencing of fungal soil samples from volcanic and non volcanic areas

PROVIDER: PRJNA1024925 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR26315168_1.fastq.gz	Fastqsanger.gz
	SRR26315168_2.fastq.gz	Fastqsanger.gz
	SRR26315169_1.fastq.gz	Fastqsanger.gz
	SRR26315169_2.fastq.gz	Fastqsanger.gz
	SRR26315170_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 16

Similar Datasets

High throughput sequencing of bacterial soil samples from volcanic and non volcanic areas

Project description:High throughput sequencing of bacterial soil samples from volcanic and non volcanic areas Raw sequence reads

| PRJNA1024930 | ENA

Microbial life in geothermal and volcanic areas

Project description:Microbial life in geothermal and volcanic areas

| PRJEB9039 | ENA

volcanic fungal community

Project description:volcanic fungal community Raw sequence reads

| PRJNA911411 | ENA

volcanic bacterial community

Project description:volcanic bacterial community Raw sequence reads

| PRJNA911355 | ENA

Northeast Fungal Diversity In Agricultural areas

Project description:Northeast Thailand Fungal Diversity In Agricultural areas Raw sequence reads

| PRJNA1118038 | ENA

Effort versus Reward: Preparing Samples for Fungal Community Characterization in High-Throughput Sequencing Surveys of Soils.

Project description:Next generation fungal amplicon sequencing is being used with increasing frequency to study fungal diversity in various ecosystems; however, the influence of sample preparation on the characterization of fungal community is poorly understood. We investigated the effects of four procedural modifications to library preparation for high-throughput sequencing (HTS). The following treatments were considered: 1) the amount of soil used in DNA extraction, 2) the inclusion of additional steps (freeze/thaw cycles, sonication, or hot water bath incubation) in the extraction procedure, 3) the amount of DNA template used in PCR, and 4) the effect of sample pooling, either physically or computationally. Soils from two different ecosystems in Minnesota, USA, one prairie and one forest site, were used to assess the generality of our results. The first three treatments did not significantly influence observed fungal OTU richness or community structure at either site. Physical pooling captured more OTU richness compared to individual samples, but total OTU richness at each site was highest when individual samples were computationally combined. We conclude that standard extraction kit protocols are well optimized for fungal HTS surveys, but because sample pooling can significantly influence OTU richness estimates, it is important to carefully consider the study aims when planning sampling procedures.

| S-EPMC4431839 | biostudies-literature

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

High-throughput proteomics of nanogram-scale samples with Zeno SWATH DIA

Project description:The ability to conduct high-quality proteomic experiments in high throughput has opened new avenues in clinical research, drug discovery, and systems biology. Next to an increase in quantitative precision, recent developments in high-throughput proteomics have also gained proteomic depth, to the extent that earlier gaps between classic and high-throughput experiments have significantly narrowed. Here we introduce and benchmark Zeno SWATH, a data-independent acquisition technique that employs a linear ion trap pulsing (Zeno trap pulsing) in order to increase proteomic depth and dynamic range in proteomic experiments. Combined with the high acquisition speed, these gains in sensitivity are particularly attractive for conducting high-throughput proteomics experiments with high chromatographic flow rates and fast gradients. We demonstrate that when combined with either micro-flow- or analytical-flow-rate chromatography, Zeno SWATH increases protein identification in complex samples 5- to 10-fold when compared to current SWATH acquisition methods on the same instrument. Using 20-min micro-flow chromatography, Zeno SWATH identified > 6,000 proteins from a 62.5 ng load of human cell lysate with more than 5,000 proteins consistently quantified in triplicate injections with a median CV of 6%. Using 5-min analytical-flow-rate chromatography (800 µl/min), Zeno SWATH identified 4,907 proteins from a triplicate injection of 2 µg of a human cell lysate; or more than 3,000 proteins from 250 ng tryptic digest. Zeno SWATH hence facilitates precise proteomic experiments with small sample amounts using a fast and robust high flow-rate chromatographic method, broadening the application space that requires precise proteomic experiments on a large scale.

2022-12-01 | PXD036786 | Pride

Clinical study on diagnosis of colorectal cancer based on high-throughput tumor antigen polypeptides screening

Project description:Interventions: Gold Standard:Pathological diagnosis;Index test:high-throughput tumor antigen polypeptides screening Primary outcome(s): Diagnostic accuracy Study Design: Factorial

| 2704426 | ecrin-mdr-crc

The molecular characteristics of low-grade and high-grade areas in desmoplastic infantile astrocytoma / ganglioglioma [RNA-seq]

Project description:A distinctive feature of the histopathology of desmoplastic infantile astrocytomas and gangliogliomas (DIA/DIGs) is a combination of low-grade and high-grade areas. In this study, we test the hypothesis that low-grade and high-grade areas in DIA/DIGs have distinct molecular characteristics. Tissue samples from microdissected low-grade and high-grade areas in 12 DIA/DIGs were analyzed by DNA methylome profiling, whole exome sequencing, RNA sequencing, and immunohistochemistry. Copy number variants among the tumours and between the two morphologically distinct areas were infrequent. No recurrent genetic alterations were identified across the tumor series, and high-grade areas did not have additional genetic alterations to explain their distinct morphology or biological behaviour. However, high-grade areas showed relative hypomethylation in genes downstream of the transcription factors SOX9 and LEF1 and evidence of a core SOX9 transcription network alongside activation of the BMP, WNT, and MAPK signalling pathways. This study contributes to our knowledge of molecular genetic alterations in DIA/DIGs, uncovers molecular differences between the two distinct cell populations in these tumours, and suggests potential therapeutic targets among the more proliferative cell population in DIA/DIGs.

2022-05-24 | GSE193129 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data