Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1028363 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR26390523.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 1 of 1 |
Similar Datasets
Project description:The current study provides an opportunity to identify specific MHC I motifs in vitro.The combination of random peptide library,LC-MS/MS and De Novo Sequencing can be an important complement to the identification of MHC I motif.
2021-09-09 | PXD019523 | Pride
Project description:The current study provides an opportunity to identify specific MHC I motifs in vitro. The combination of random peptide library, LC-MS/MS and De Novo Sequencing can be an important complement to the identification of MHC I motif. Insight into the length distribution of MHC-I binding peptides helps us better understand the molecular mechanism.
2022-02-25 | PXD020818 | Pride
Project description:Display technologies, e.g., phage, ribosome, mRNA, bacterial, and yeast-display, combine high content peptide libraries with appropriate screening strategies to identify functional peptide sequences. Construction of large peptide library and display-screen system in intact mammalian cells will facilitate the development of peptide therapeutics targeting transmembrane proteins. Our previous work established linear-double-stranded DNAs (ldsDNAs) as innovative biological parts to implement AND gate genetic circuits in mammalian cell line. In the current study, we employ ldsDNA with terminal NNK degenerate codons as AND gate input to build highly diverse peptide library in mammalian cells. Only PCR reaction and cell transfection experiments are needed to construct the library. High-throughput sequencing (HTS) results reveal that our new strategy could generate peptide library with both amino acid sequence and peptide length diversities. Our work establishes ldsDNA as biological parts for building highly diverse peptide library in mammalian cells, which shows great application potential in developing therapeutic peptides targeting transmembrane proteins.
2020-07-19 | GSE134671 | GEO
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress
Project description:NGPS is a method for de-novo, full-length protein sequencing in high throughput. The method is based on cleavage of the protein at semi-random sites by microwave-assisted acid hydrolysis (MAAH), enrichment of LC-MS/MS amenable peptides from the hydrolysate by solid-phase-extraction, LC-MS/MS analysis, de-novo long peptide tag sequencing of resulting peptides and assembly of peptide tags into consensus contigs.
2017-04-03 | PXD003804 | Pride
Project description:Paired-end deep-sequencing was used to determine in parallel the status and position of sister-chromatid contact (SC2) reporters and/or site-specific recombinase (SSR) activity reporters inserted at random positions in a library of cells. The SC2 reporters are short recombination cassettes for a topology-independent site-specific recombinase (Cre or Xer). The SSR-activity reporters are long recombination cassettes. The SC2 reporter cassettes are composed of two directly-repeated recombination sites separated by a DNA segment too short to permit their excision by intramolecular recombination. The SSR-activity cassettes are composed of two directly-repeated recombination sites separated by a DNA segment long enough to permit their excision by intramolecular recombination. The assays start with the engineering of a cell line with a conditional expression allele for Cre or Xer and the creation of a library of cells harbouring a cognate SC2 or SSR-activity reporter at different genomic positions. Production of the recombinase was induced for different lengths of time during cell growth and/or at specific stages of the cell cycle. The position of the SC2 reporter harboured by each cell and the recombination status of the recombination cassette it contains are then determined by high-throughput paired-end sequencing.
2020-07-07 | E-MTAB-8946 | biostudies-arrayexpress
Project description:Maintenance of open and repressed chromatin states is crucial for regulation of gene expression. To study the genes involved in maintaining chromatin states we generated a random mutant library using the Hermes transposon mutagenesis system in fission yeast Schizosacchromyces pombe. The silencing of reporter genes inserted in the euchromatic region adjacent to the heterochromatic mating type locus was monitored. We identified Leo1-Paf1, a subcomplex of the RNA Polymerase II Associated Factor 1 Complex (Paf1C), required to prevent spreading of heterochromatin into euchromatin. Through high-resolution genome-wide ChIP (ChIP-exo) we mapped the heterochromatin mark H3K9me2 in leo1∆ cells. Loss of Leo1-Paf1 led to increased heterochromatin stability at several facultative heterochromatin loci. The RNAi machinery is the major pathway for heterochromatin formation in S. pombe. However, small RNA sequencing showed that heterochromatin assembly in leo1∆ cells was RNAi-independent. By examining histone turnover rate in leo1∆ cells, we showed that deletion of Leo1 decreased nucleosome turnover, which led to heterochromatin spreading. Our data revealed that Leo1-Paf1 promotes chromatin state fluctuations by enhancing histone turnover.
2015-10-18 | GSE66940 | GEO
Project description:Maintenance of open and repressed chromatin states is crucial for regulation of gene expression. To study the genes involved in maintaining chromatin states we generated a random mutant library using the Hermes transposon mutagenesis system in fission yeast Schizosacchromyces pombe. The silencing of reporter genes inserted in the euchromatic region adjacent to the heterochromatic mating type locus was monitored. We identified Leo1-Paf1, a subcomplex of the RNA Polymerase II Associated Factor 1 Complex (Paf1C), required to prevent spreading of heterochromatin into euchromatin. Through high-resolution genome-wide ChIP (ChIP-exo) we mapped the heterochromatin mark H3K9me2 in leo1∆ cells. Loss of Leo1-Paf1 led to increased heterochromatin stability at several facultative heterochromatin loci. The RNAi machinery is the major pathway for heterochromatin formation in S. pombe. However, small RNA sequencing showed that heterochromatin assembly in leo1∆ cells was RNAi-independent. By examining histone turnover rate in leo1∆ cells, we showed that deletion of Leo1 decreased nucleosome turnover, which led to heterochromatin spreading. Our data revealed that Leo1-Paf1 promotes chromatin state fluctuations by enhancing histone turnover.
2015-10-18 | GSE66939 | GEO
Project description:Trypanosoma brucei library consisting of a pool of reporters whose 14Ts polypyrimidine tract is replaced with 11 random nucleotides. The library is treated with puromycin at a concentration of either 0.2ug/ml, 0.4ug/ml or 1ug/ml. The reporters are recovered and PCR amplicons targeting the random sequences identified by HTS. The results are paired reads, where the suffixes _1 and _2 are reads 1 and 2 respectively. Also included are sequencing results from the plasmid library.
2022-04-29 | E-MTAB-11647 | biostudies-arrayexpress
Project description:In this paper several computer programs were used to simulate in situ synthesis of peptides using shadow masks and BOC synthesis. The peptides were designed to be random, or pseudo-random, but fulfill requirements of immunosignaturing. This file contains data from actual 330,000 peptide arrays that used the first iteration of the peptide generation algorithm. Monoclonal antibodies were bound to the microarrays and the total number of peptides that distinguished each monoclonal was measured. This provides a baseline against which to compare purely random sequences.
2014-01-16 | GSE50571 | GEO