Project description:The current study provides an opportunity to identify specific MHC I motifs in vitro.The combination of random peptide library,LC-MS/MS and De Novo Sequencing can be an important complement to the identification of MHC I motif.
2021-09-09 | PXD019523 | Pride
Project description:Screening results of a random peptide-displaying phage library
Project description:The current study provides an opportunity to identify specific MHC I motifs in vitro. The combination of random peptide library, LC-MS/MS and De Novo Sequencing can be an important complement to the identification of MHC I motif. Insight into the length distribution of MHC-I binding peptides helps us better understand the molecular mechanism.
Project description:Display technologies, e.g., phage, ribosome, mRNA, bacterial, and yeast-display, combine high content peptide libraries with appropriate screening strategies to identify functional peptide sequences. Construction of large peptide library and display-screen system in intact mammalian cells will facilitate the development of peptide therapeutics targeting transmembrane proteins. Our previous work established linear-double-stranded DNAs (ldsDNAs) as innovative biological parts to implement AND gate genetic circuits in mammalian cell line. In the current study, we employ ldsDNA with terminal NNK degenerate codons as AND gate input to build highly diverse peptide library in mammalian cells. Only PCR reaction and cell transfection experiments are needed to construct the library. High-throughput sequencing (HTS) results reveal that our new strategy could generate peptide library with both amino acid sequence and peptide length diversities. Our work establishes ldsDNA as biological parts for building highly diverse peptide library in mammalian cells, which shows great application potential in developing therapeutic peptides targeting transmembrane proteins.
Project description:Maintenance of open and repressed chromatin states is crucial for regulation of gene expression. To study the genes involved in maintaining chromatin states we generated a random mutant library using the Hermes transposon mutagenesis system in fission yeast Schizosacchromyces pombe. The silencing of reporter genes inserted in the euchromatic region adjacent to the heterochromatic mating type locus was monitored. We identified Leo1-Paf1, a subcomplex of the RNA Polymerase II Associated Factor 1 Complex (Paf1C), required to prevent spreading of heterochromatin into euchromatin. Through high-resolution genome-wide ChIP (ChIP-exo) we mapped the heterochromatin mark H3K9me2 in leo1∆ cells. Loss of Leo1-Paf1 led to increased heterochromatin stability at several facultative heterochromatin loci. The RNAi machinery is the major pathway for heterochromatin formation in S. pombe. However, small RNA sequencing showed that heterochromatin assembly in leo1∆ cells was RNAi-independent. By examining histone turnover rate in leo1∆ cells, we showed that deletion of Leo1 decreased nucleosome turnover, which led to heterochromatin spreading. Our data revealed that Leo1-Paf1 promotes chromatin state fluctuations by enhancing histone turnover.
Project description:Maintenance of open and repressed chromatin states is crucial for regulation of gene expression. To study the genes involved in maintaining chromatin states we generated a random mutant library using the Hermes transposon mutagenesis system in fission yeast Schizosacchromyces pombe. The silencing of reporter genes inserted in the euchromatic region adjacent to the heterochromatic mating type locus was monitored. We identified Leo1-Paf1, a subcomplex of the RNA Polymerase II Associated Factor 1 Complex (Paf1C), required to prevent spreading of heterochromatin into euchromatin. Through high-resolution genome-wide ChIP (ChIP-exo) we mapped the heterochromatin mark H3K9me2 in leo1∆ cells. Loss of Leo1-Paf1 led to increased heterochromatin stability at several facultative heterochromatin loci. The RNAi machinery is the major pathway for heterochromatin formation in S. pombe. However, small RNA sequencing showed that heterochromatin assembly in leo1∆ cells was RNAi-independent. By examining histone turnover rate in leo1∆ cells, we showed that deletion of Leo1 decreased nucleosome turnover, which led to heterochromatin spreading. Our data revealed that Leo1-Paf1 promotes chromatin state fluctuations by enhancing histone turnover.
Project description:NGPS is a method for de-novo, full-length protein sequencing in high throughput. The method is based on cleavage of the protein at semi-random sites by microwave-assisted acid hydrolysis (MAAH), enrichment of LC-MS/MS amenable peptides from the hydrolysate by solid-phase-extraction, LC-MS/MS analysis, de-novo long peptide tag sequencing of resulting peptides and assembly of peptide tags into consensus contigs.
Project description:To directly test how individual TFs combine their functions to open chromatin at specific loci, we used synthetic DNA sequences. We generated a library containing all combinations of TF-motif deletions for three CREs: a CTCF-bound region as a positive control (found in \"MutLib1\"), an enhancer with five KLF4 motifs (found in \"MutLib2\"), and a promoter with YY1, NRF1, and MYC motifs (found in \"MutLib1\"). We then inserted the library into a landing pad within a neutral chromatin environment, devoid of activating or repressive chromatin modifications, in mESCs using Recombination-Mediated Cassette Exchange (RMCE). Chromatin accessibility of the inserted fragments was then profiled by targeted SMF using PCR primers that anneal to a synthetic flanking sequence, allowing unambiguous differentiation of the ectopic site from its endogenous counterpart. The dataset generated includes amplicon-based SMF data from the ectopic site under steady-state conditions, in mouse cells (i.e., TC-1 knock-out of the three DNA methyl transferases (DNMT TKO) mESCs). Two biological replicates were generated. In summary, cells were collected for SMF, which marks accessible cytosines via recombinant methyltransferases, followed by bisulfite sequencing to infer protein-DNA interactions and chromatin accessibility at single-molecule resolution. The sequencing library was prepared using the NEBNext DNA Ultra II Library Prep Kit and sequenced on an Illumina platform, using either a MiSeq 250 bp paired-end run, a MiSeq i100 250 bp paired-end run, or a NextSeq 2000 P1 300 bp paired-end run. Reads were pre-processed with TrimGalore and a custom R script was used to trim the plasmid backbone from the reads. After, pre-processed reads were aligned using QuasR. Further analyses were conducted using custom scripts available at https://github.com/Krebslabrep/TF-chromatin.git.
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
Project description:Paired-end deep-sequencing was used to determine in parallel the status and position of sister-chromatid contact (SC2) reporters and/or site-specific recombinase (SSR) activity reporters inserted at random positions in a library of cells. The SC2 reporters are short recombination cassettes for a topology-independent site-specific recombinase (Cre or Xer). The SSR-activity reporters are long recombination cassettes. The SC2 reporter cassettes are composed of two directly-repeated recombination sites separated by a DNA segment too short to permit their excision by intramolecular recombination. The SSR-activity cassettes are composed of two directly-repeated recombination sites separated by a DNA segment long enough to permit their excision by intramolecular recombination. The assays start with the engineering of a cell line with a conditional expression allele for Cre or Xer and the creation of a library of cells harbouring a cognate SC2 or SSR-activity reporter at different genomic positions. Production of the recombinase was induced for different lengths of time during cell growth and/or at specific stages of the cell cycle. The position of the SC2 reporter harboured by each cell and the recombination status of the recombination cassette it contains are then determined by high-throughput paired-end sequencing.