Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1031079 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR26467335_1.fastq.gz | Fastqsanger.gz | |||
| SRR26467335_2.fastq.gz | Fastqsanger.gz | |||
| SRR26467336_1.fastq.gz | Fastqsanger.gz | |||
| SRR26467336_2.fastq.gz | Fastqsanger.gz | |||
| SRR26467337_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 68 |
Similar Datasets
Project description:Comparison of probe-target dissociations of probe Eub338 and Gam42a with native RNA of P. putida, in vitro transcribed 16s rRNA of P. putida, in vitro transcribed 16S rRNA of a 2,4,6-trinitrotoluene contaminated soil and an uncontaminated soil sample. Functional ANOVA revealed no significant differences in the dissociation curves of probe Eub338 when hybridised to the different samples. On the opposite, the dissociation curve of probe Gam42a with native RNA of P. putida was significantly different than the dissociation curves obtained with in vitro transcribed 16S rRNA samples. Keywords: Microbial diversity, thermal dissociation analysis, CodeLink microarray
2005-11-05 | GSE3525 | GEO
Project description:Despite the global importance of forests, it is virtually unknown how their soil microbial communities adapt at the phylogenetic and functional level to long term metal pollution. Studying twelve sites located along two distinct gradients of metal pollution in Southern Poland revealed that both community composition (via MiSeq Illumina sequencing of 16S rRNA genes) and functional gene potential (using GeoChip 4.2) were highly similar across the gradients despite drastically diverging metal contamination levels. Metal pollution level significantly impacted microbial community structure (p = 0.037), but not bacterial taxon richness. Metal pollution altered the relative abundance of specific bacterial taxa, including Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Planctomycetes and Proteobacteria. Also, a group of metal resistance genes showed significant correlations with metal concentrations in soil, although no clear impact of metal pollution levels on overall functional diversity and structure of microbial communities was observed. While screens of phylogenetic marker genes, such as 16S rRNA, provided only limited insight into resilience mechanisms, analysis of specific functional genes, e.g. involved in metal resistance, appeared to be a more promising strategy. This study showed that the effect of metal pollution on soil microbial communities was not straightforward, but could be filtered out from natural variation and habitat factors by multivariate statistical analysis and spatial sampling involving separate pollution gradients.
2014-07-22 | GSE59620 | GEO
Project description:Accurate description of a microbial community is an important first step in understanding the role of its components in ecosystem function. A method for surveying microbial communities termed Serial Analysis of Ribosomal DNA (SARD) is described here. Through a series of molecular cloning steps, short DNA sequence tags are recovered from the fifth variable (V5) region of the prokaryotic 16S rRNA gene from microbial communities. These tags are ligated to form concatemers comprised of 20-40 tags which are cloned and identified by DNA sequencing. Four agricultural soil samples were profiled with SARD to assess the method’s utility. A total of 37,008 SARD tags comprising 3,127 unique sequences were identified. Comparison of duplicate profiles from one soil genomic DNA preparation revealed the method was highly reproducible. The large numbers of singleton tags together with non-parametric richness estimates indicated a significant amount of sequence tag diversity remained undetected with this level of sampling. The abundance classes of the observed tags were scale-free and conformed to a power law distribution. Numerically, the majority of the total tags observed belonged to abundance classes that were each present at less than 1% of the community. Over 99% of the unique tags individually made up less than 1% of the community. Therefore, from either numerical or diversity standpoints, low abundant taxa comprised a significant proportion of the microbial communities examined and could potentially make a large contribution to ecosystem function. SARD may provide a means to explore the ecological role of these rare members of microbial communities in qualitative and quantitative terms. Keywords: SARD profiles, culture-independent study, microbial community survey, microbial census
2007-06-15 | GSE8119 | GEO
Project description:Despite the global importance of forests, it is virtually unknown how their soil microbial communities adapt at the phylogenetic and functional level to long term metal pollution. Studying twelve sites located along two distinct gradients of metal pollution in Southern Poland revealed that both community composition (via MiSeq Illumina sequencing of 16S rRNA genes) and functional gene potential (using GeoChip 4.2) were highly similar across the gradients despite drastically diverging metal contamination levels. Metal pollution level significantly impacted microbial community structure (p = 0.037), but not bacterial taxon richness. Metal pollution altered the relative abundance of specific bacterial taxa, including Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Planctomycetes and Proteobacteria. Also, a group of metal resistance genes showed significant correlations with metal concentrations in soil, although no clear impact of metal pollution levels on overall functional diversity and structure of microbial communities was observed. While screens of phylogenetic marker genes, such as 16S rRNA, provided only limited insight into resilience mechanisms, analysis of specific functional genes, e.g. involved in metal resistance, appeared to be a more promising strategy. This study showed that the effect of metal pollution on soil microbial communities was not straightforward, but could be filtered out from natural variation and habitat factors by multivariate statistical analysis and spatial sampling involving separate pollution gradients. 12 samples were collected from two long-term polluted areas (Olkusz and Miasteczko M-EM-^ZlM-DM-^Eskie) in Southern Poland. In the study presented here, a consecutively operated, well-defined cohort of 50 NSCLC cases, followed up more than five years, was used to acquire expression profiles of a total of 8,644 unique genes, leading to the successful construction of supervised
2014-07-22 | E-GEOD-59620 | biostudies-arrayexpress
Project description:To effectively monitor microbial populations in acidic environments and bioleaching systems, a comprehensive 50-mer-based oligonucleotide microarray was developed based on most of the known genes associated with the acidophiles. This array contained 1,072 probes in which there were 571 related to 16S rRNA and 501 related to functional genes. Acid mine drainage (AMD) presents numerous problems to the aquatic life and surrounding ecosystems. However, little is known about the geographic distribution, diversity, composition, structure and function of AMD microbial communities. In this study, we analyzed the geographic distribution of AMD microbial communities from twenty sites using restriction fragment length polymorphism (RFLP) analysis of 16S rRNA genes, and the results showed that AMD microbial communities were geographically distributed and had high variations among different sites. Then an AMD-specific microarray was used to further analyze nine AMD microbial communities, and showed that those nine AMD microbial communities had high variations measured by the number of detected genes, overlapping genes between samples, unique genes, and diversity indices. Statistical analyses indicated that the concentrations of Fe, S, Ca, Mg, Zn, Cu and pH had strong impacts on both phylogenetic and functional diversity, composition, and structure of AMD microbial communities. This study provides insights into our understanding of the geographic distribution, diversity, composition, structure and functional potential of AMD microbial communities and key environmental factors shaping them. This study investigated the geographic distribution of Acid Mine Drainages microbial communities using a 16S rRNA gene-based RFLP method and the diversity, composition and structure of AMD microbial communities phylogenetically and functionally using an AMD-specific microarray which contained 1,072 probes ( 571 related to 16S rRNA and 501 related to functional genes). The functional genes in the microarray were involved in carbon metabolism (158), nitrogen metabolism (72), sulfur metabolism (39), iron metabolism (68), DNA replication and repair (97), metal-resistance (27), membrane-relate gene (16), transposon (13) and IST sequence (11).
2011-03-08 | E-GEOD-27542 | biostudies-arrayexpress
Project description:Understanding the environmental factors that shape microbial communities is crucial, especially in extreme environments, like Antarctica. Two main forces were reported to influence Antarctic soil microbes: birds and plants. Both birds and plants are currently undergoing unprecedented changes in their distribution and abundance due to global warming. However, we need to clearly understand the relationship between plants, birds and soil microorganisms. We therefore collected rhizosphere and bulk soils from six different sampling sites subjected to different levels of bird influence and colonized by Colobanthus quitensis and Deschampsia antarctica in the Admiralty Bay, King George Island, Maritime Antarctic. Microarray and qPCR assays targeting 16S rRNA genes of specific taxa were used to assess microbial community structure, composition and abundance and analyzed with a range of soil physico-chemical parameters. The results indicated significant rhizosphere effects in four out of the six sites, including areas with different levels of bird influence. Acidobacteria were significantly more abundant in soils with little bird influence (low nitrogen) and in bulk soil. In contrast, Actinobacteria were significantly more abundant in the rhizosphere of both plant species. At two of the sampling sites under strong bird influence (penguin colonies), Firmicutes were significantly more abundant in D. antarctica rhizosphere but not in C. quitensis rhizosphere. The Firmicutes were also positively and significantly correlated to the nitrogen concentrations in the soil. We conclude that the microbial communities in Antarctic soils are driven both by bird and plants, and that the effect is taxa-specific.
2012-06-01 | GSE33847 | GEO
Project description:Soil transplant serves as a proxy to simulate climate change in realistic climate regimes. Here, we assessed the effects of climate warming and cooling on soil microbial communities, which are key drivers in Earth’s biogeochemical cycles, four years after soil transplant over large transects from northern (N site) to central (NC site) and southern China (NS site) and vice versa. Four years after soil transplant, soil nitrogen components, microbial biomass, community phylogenetic and functional structures were altered. Microbial functional diversity, measured by a metagenomic tool named GeoChip, and phylogenetic diversity are increased with temperature, while microbial biomass were similar or decreased. Nevertheless, the effects of climate change was overridden by maize cropping, underscoring the need to disentangle them in research. Mantel tests and canonical correspondence analysis (CCA) demonstrated that vegetation, climatic factors (e.g., temperature and precipitation), soil nitrogen components and CO2 efflux were significantly correlated to the microbial community composition. Further investigation unveiled strong correlations between carbon cycling genes and CO2 efflux in bare soil but not cropped soil, and between nitrogen cycling genes and nitrification, which provides mechanistic understanding of these microbe-mediated processes and empowers an interesting possibility of incorporating bacterial gene abundance in greenhouse gas emission modeling.
2013-10-30 | GSE51592 | GEO
Project description:Tibet is one of the most threatened regions by climate warming, thus understanding how its microbial communities function may be of high importance for predicting microbial responses to climate changes. Here, we report a study to profile soil microbial structural genes, which infers functional roles of microbial communities, along four sites/elevations of a Tibetan mountainous grassland, aiming to explore potential microbial responses to climate changes via a strategy of space-for-time substitution. Using a microarray-based metagenomics tool named GeoChip 4.0, we showed that microbial communities were distinct for most but not all of the sites. Substantial variations were apparent in stress, N and C cycling genes, but they were in line with the functional roles of these genes. Cold shock genes were more abundant at higher elevations. Also, gdh converting ammonium into urea was more abundant at higher elevations while ureC converting urea into ammonium was less abundant, which was consistent with soil ammonium contents. Significant correlations were observed between N-cycling genes (ureC, gdh and amoA) and nitrous oxide flux, suggesting that they contributed to community metabolism. Lastly, we found by CCA, Mantel tests and the similarity tests that soil pH, temperature, NH4+–N and vegetation diversity accounted for the majority (81.4%) of microbial community variations, suggesting that these four attributes were major factors affecting soil microbial communities. Based on these observations, we predict that climate changes in the Tibetan grasslands are very likely to change soil microbial community functional structure, with particular impacts on microbial N cycling genes and consequently microbe-mediated soil N dynamics.
2013-07-13 | GSE48820 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction
2010-01-01 | GSE18711 | GEO