Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Classifying pathogenic variants in amyloid beta using intramolecular genetic interaction profiling

ABSTRACT: Classifying pathogenic variants in amyloid beta using intramolecular genetic interaction profiling

PROVIDER: PRJNA1039772 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Similar Datasets

Classifying pathogenic variants in amyloid beta using intramolecular genetic interaction profiling

Project description:Changes in the amino acid sequences of proteins cause thousands of human genetic diseases. However, only a subset of variants in any protein is typically pathogenic, with variants having a diversity of molecular consequences. Determining which of the thousands of possible variants in any protein have similar molecular effects is very challenging, but crucial for identifying pathogenic variants, determining disease mechanisms, understanding clinical phenotypic variation, and developing targeted therapeutics. Here we present a general method to classify variants by their molecular effects that we term intramolecular genetic interaction profiling. The approach relies on the principle that variants with similar molecular consequences have similar genetic interactions with other variants in the same protein. These intramolecular genetic interactions are straightforward to quantify for any protein with a selectable function. We apply intramolecular genetic interaction profiling to amyloid beta, the protein that aggregates in Alzheimer’s disease (AD) and is mutated in familial AD (fAD). Genetic interactions identify two classes of gain-of-function variants, with all known familial Alzheimer’s disease variants having very similar genetic interaction profiles, consistent with a common gain-of-function mechanism leading to pathology. We believe that intramolecular genetic interaction profiling is a powerful approach for classifying variants in disease genes that will empower rare variant association studies and the discovery of disease mechanisms.

2023-11-15 | GSE247583 | GEO

An autoinhibitory intramolecular interaction proof-reads RNA recognition by the essential splicing factor U2AF2

Project description:An autoinhibitory intramolecular interaction proof-reads RNA recognition by the essential splicing factor U2AF2

| PRJNA522997 | ENA

RNA Proximity Ligation to Resolve Intramolecular RNA Structures in situ

Project description:Proof-of-concept of a new method involving the limited digestion and subsequent ligation of intramolecular RNA structures in situ followed by deep sequencing Proof-of-concept of RPL in S. cerevisiae and H. sapiens tissue culture

2015-08-01 | E-GEOD-69472 | biostudies-arrayexpress

RNA Proximity Ligation to Resolve Intramolecular RNA Structures in situ

Project description:Proof-of-concept of a new method involving the limited digestion and subsequent ligation of intramolecular RNA structures in situ followed by deep sequencing

2015-08-01 | GSE69472 | GEO

Mislocalization of pathogenic RBM20 variants in dilated cardiomyopathy is caused by loss-of-interaction with Transportin-3

Project description:Severe forms of dilated cardiomyopathy (DCM) are associated with point mutations in the alternative splicing regulator RBM20 that are frequently located in the arginine/serine-rich domain (RS-domain). Such mutations can cause defective splicing and cytoplasmic mislocalization, which leads to the formation of detrimental cytoplasmic granules. Successful development of personalized therapies requires identifying the direct mechanisms of pathogenic RBM20 variants. Here, we decipher the molecular mechanism of RBM20 mislocalization and its specific role in DCM pathogenesis. We demonstrate that mislocalized RBM20 variants retain their splice regulatory activity, which reveals that aberrant cellular localization drives the pathological phenotype. A genome-wide CRISPR knock-out screen combined with image-enabled cell sorting identified Transportin-3 (TNPO3) as the main nuclear importer of RBM20. We show that the direct RBM20-TNPO3 interaction involves the RS-domain, disrupted by pathogenic variants. Re-localization of pathogenic RBM20 variants to the nucleus restores alternative splicing and dissolves cytoplasmic granules in cell culture and animal models. These findings provide proof-of-principle for developing therapeutic strategies to restore RBM20’s nuclear localization in RBM20-DCM patients.

2023-06-19 | PXD038790 | Pride

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

Mislocalization of pathogenic RBM20 variants in dilated cardiomyopathy is caused by loss-of-interaction with Transportin-3

Project description:Mislocalization of pathogenic RBM20 variants in dilated cardiomyopathy is caused by loss-of-interaction with Transportin-3

| PRJNA911636 | ENA

Interaction of soil amoeba Protostelium aurantium with three pathogenic yeasts Candida spp.

Project description:Interaction of soil amoeba Protostelium aurantium with three pathogenic yeasts Candida spp.

| PRJNA478939 | ENA

Deciphering Early Pathogenic Changes in Alzheimer's disease

Project description:The aim of the present project is to detect biochemical alterations that can pinpoint specific pathogenic processes at early phases of AD, evaluated in the cerebrospinal fluid, that more closely reflect the pathogenic processes in the brain, and independently of whether an amyloid response was triggered.

2024-05-24 | PXD039563 | Pride

Checkpoint-independent Regulation of Origin Firing by Mrc1 through Interaction with Hsk1 kinase

Project description:Mrc1 is a conserved checkpoint mediator protein that transduces replication-stress signal to downstream effector kinase. Loss of mrc1 checkpoint activity results in aberrant activation of late/dormant origins in the presence of hydroxyurea. Mrc1 was also suggested to regulate orders of early-origin firing in a checkpoint-independent manner, but its mechanism was unknown. Here we identify HBS (Hsk1 Bypass Segment) on Mrc1. ∆HBS does not suppress late/dormant origin firing in the presence of hydroxyurea but causes precocious and enhanced activation of weak early-firing origins during normal S-phase progression, and bypasses the requirement of Hsk1 for growth. This may be caused by disruption of intramolecular binding between HBS and NTHBS (N-terminal-Target-of-HBS). Hsk1 binds to Mrc1 through HBS and phosphorylates a segment adjacent to NTHBS, disrupting intramolecular interaction. We propose that Mrc1 exerts “brake” on initiation (through intra-molecular interaction) and this brake can be released (upon loss of intra-molecular interaction) by either Hsk1-mediated phosphorylation of Mrc1 or deletion of HBS (or phosphomimic mutation) which can bypass the function of Hsk1 for growth. The “brake” mechanism may explain the checkpoint-independent regulation of early origin firing in fission yeast.

2017-01-06 | GSE93178 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data