Therapeutic application of circular RNA aptamers in a mouse model of psoriasis
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1045575 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR26958107_1.fastq.gz | Fastqsanger.gz | |||
| SRR26958107_2.fastq.gz | Fastqsanger.gz | |||
| SRR26958108_1.fastq.gz | Fastqsanger.gz | |||
| SRR26958108_2.fastq.gz | Fastqsanger.gz | |||
| SRR26958109_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 80 |
Similar Datasets
Project description:Efforts to advance RNA aptamers as a novel therapeutic modality have been limited by their susceptibilty to degradation and immunogenicity. In a previous study, we demonstrated synthesized double-stranded circular RNAs (ds-cRNAs) with minimal immunogenicity targeted to dsRNA-activated Protein Kinase R (PKR). Here, we test the therapeutic potential of ds-cRNAs in a mouse model of imiquimod-induced psoriasis. We find that genetic supplementation of ds-cRNAs leads to inhibition of PKR, resulting in alleviation of downstream interferon alpha (IFNα)/dsRNA signals and attenuation of psoriasis phenotypes. Delivery of ds-cRNAs by lipid nanoparticles to the spleen attenuates PKR activity in examined splenocytes, resulting in reduced epidermal thickness. These findings suggest that ds-cRNAs represent a promising approach to mitigate excessive PKR activation for therapeutic purposes.
2024-03-04 | GSE248680 | GEO
Project description:Efforts to advance RNA aptamers as a novel therapeutic modality have been limited by their susceptibilty to degradation and immunogenicity. In a previous study, we demonstrated synthesized double-stranded circular RNAs (ds-cRNAs) with minimal immunogenicity targeted to dsRNA-activated Protein Kinase R (PKR). Here, we test the therapeutic potential of ds-cRNAs in a mouse model of imiquimod-induced psoriasis. We find that genetic supplementation of ds-cRNAs leads to inhibition of PKR, resulting in alleviation of downstream interferon alpha (IFNα)/dsRNA signals and attenuation of psoriasis phenotypes. Delivery of ds-cRNAs by lipid nanoparticles to the spleen attenuates PKR activity in examined splenocytes, resulting in reduced epidermal thickness. These findings suggest that ds-cRNAs represent a promising approach to mitigate excessive PKR activation for therapeutic purposes.
2024-03-04 | GSE248678 | GEO
Project description:Efforts to advance RNA aptamers as a novel therapeutic modality have been limited by their susceptibilty to degradation and immunogenicity. In a previous study, we demonstrated synthesized double-stranded circular RNAs (ds-cRNAs) with minimal immunogenicity targeted to dsRNA-activated Protein Kinase R (PKR). Here, we test the therapeutic potential of ds-cRNAs in a mouse model of imiquimod-induced psoriasis. We find that genetic supplementation of ds-cRNAs leads to inhibition of PKR, resulting in alleviation of downstream interferon alpha (IFNα)/dsRNA signals and attenuation of psoriasis phenotypes. Delivery of ds-cRNAs by lipid nanoparticles to the spleen attenuates PKR activity in examined splenocytes, resulting in reduced epidermal thickness. These findings suggest that ds-cRNAs represent a promising approach to mitigate excessive PKR activation for therapeutic purposes.
2024-03-04 | GSE253346 | GEO
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:Our group recently described a population of antigen presenting cells that appear to be critical in psoriasis pathogenesis, termed inflammatory myeloid dendritic cells (CD11c+ BDCA1-). Triggering receptor expressed on myeloid cells type-1 (TREM-1) signaling was a major canonical pathway in the published transcriptome of these cells. TREM-1 is a member of the immunoglobulin superfamily, active through the DAP12 signaling pathway, with an unknown ligand. Activation through TREM-1 induces inflammatory cytokines including IL-8, MCP/CCL2 and TNF. We now show that TREM-1 was expressed in the skin of healthy and psoriatic patients, and there was increased soluble TREM-1 in the circulation of psoriasis patients. In psoriasis lesions, TREM-1 was co-localized with dendritic cells as well as CD31+ endothelial cells. TREM-1 expression was reduced with successful NB-UVB, etanercept and anti-IL-17 treatments. An in vitro model of PGN-activated monocytes as inflammatory myeloid DCs was developed to study TREM-1 blockade, and treatment with a TREM-1 blocking chimera decreased allogeneic Th17 activation, as well as IL-17 production. Furthermore, TREM-1 blockade of ex vivo psoriatic dendritic cells in an alloMLR also showed a decrease in IL-17. Together, these data suggest that the TREM-1 signaling pathway offers a novel therapeutic target to prevent the effects of inflammatory myeloid DCs in psoriasis. Monocytes were isolated by plastic adherence, treated with TLR agonists overnight, washed twice and harvested in RTL-buffer. RNA was extracted and processed for microarray. 3 groups and 3 replicates with a paired structure across replicates
2012-11-17 | E-GEOD-42305 | biostudies-arrayexpress
Project description:Cyclotides are circular and cystine-rich peptides which are little amenable to chemical modifications for probe design in chemical biology. The cyclotide [T20K]kalata B1 is an immune system modulating drug reported for its therapeutic application in multiple sclerosis.
2017-09-26 | PXD004798 | Pride
Project description:Cyclic AMP (cAMP) has a key role in psoriasis pathogenesis, as indicated by the therapeutic efficacy of phosphodiesterase inhibitors that prevent the degradation of cAMP. However, whether soluble adenylate cyclase (sAC) (encoded by the ADCY10 gene), which is an important source for cAMP, is involved in Th17 cell-mediated inflammation or could be an alternative therapeutic target in psoriasis is unknown. We have utilized the imiquimod model of murine psoriasiform dermatitis to address this question. Adcy10-/- mice had reduced erythema, scaling and swelling in the skin and Th17 cell numbers in the draining lymph nodes, compared with wild-type mice after induction of psoriasiform dermatitis with imiquimod. During Th17 polarization in vitro, naïve T cells from Adcy10-/- mice were unable to differentiate to Th17 cells and RNA-seq analysis revealed that sAC was also essential for Th17 cell activation. Interestingly, sAC did not impact Th17 lineage-defining transcription factors (such as RORc and cMAF) but rather was required for CREB-dependent gene expression. Finally, topical application of small molecule sAC inhibitors (sACi) reduced imiquimod-induced psoriasiform dermatitis and IL17 gene expression in the skin. Collectively, these findings demonstrate that sAC is a key factor for inducing type 17 inflammation in the skin and sACi could provide an alternative class of topical therapeutics for psoriasis.
2021-10-01 | GSE175470 | GEO
Project description:Efforts to advance RNA aptamers as a novel therapeutic modality have been limited by their susceptibilty to degradation and immunogenicity. In a previous study, we demonstrated synthesized double-stranded circular RNAs (ds-cRNAs) with minimal immunogenicity targeted to dsRNA-activated Protein Kinase R (PKR). Here, we test the therapeutic potential of ds-cRNAs in a mouse model of imiquimod-induced psoriasis. We find that genetic supplementation of ds-cRNAs leads to inhibition of PKR, resulting in alleviation of downstream interferon alpha (IFNα)/dsRNA signals and attenuation of psoriasis phenotypes. Delivery of ds-cRNAs by lipid nanoparticles to the spleen attenuates PKR activity in examined splenocytes, resulting in reduced epidermal thickness. These findings suggest that ds-cRNAs represent a promising approach to mitigate excessive PKR activation for therapeutic purposes.
2024-03-04 | GSE248679 | GEO
Project description:Target specific short single-stranded DNA (ssDNA) molecules, called aptamers, are auspicious ligands for numerous in vivo applications. However, aptamers are synthetic molecules, which might be recognized by the immune cells in vivo and induce an activation of the innate immune system. Thus, immune activation potential of synthetic ssDNA oligonucleotides (ODNs) was determined using a well established closed-loop circulation model. Fresh human blood was incubated at 37°C for 2 or 4 hours with ssDNA ODNs (SB_ODN) or CpG ODN as positive control. Transcriptional changes were determined by microarray analyses. Blood samples containing SB_ODN demonstrated after 4 hours a significant regulation of 295 transcripts. Amongst others, CCL8, CXCL10, CCL7 and CXCL11 were highest regulated genes. Gene Ontology terms and KEGG pathway analyses exhibited that the differentially expressed genes belong to the transcripts that are regulated during an immune and inflammatory response, and were overrepresented in TLR signaling pathway. This study shows for the first time the potential of aptamers to activate immune system after systemic application into the human blood. Thus, we highly recommend performing of these preclinical tests with potential aptamer-based therapeutics. To evaluate the influence of synthetic ssDNA oligonucleotides (SB_ODN, CpG_ODN) on the cells of circulating peripheral blood (n=3), the samples were divided into 7 groups, 0h_without ssDNA, 2h_without ssDNA, 2h_with SB_ODN, 2h_with CpG_ODN, 4h_without ssDNA, 4h_with SB_ODN, 4h_with CpG_ODN. Baseline value samples (0h_without ssDNA) were obtained after blood collection without rotating in the closed-loop model. Negative control samples (2h_without ssDNA and 4h_without ssDNA) did not include oligonucleotides but rotated in the closed-loop model.
2013-05-07 | E-GEOD-46676 | biostudies-arrayexpress
Project description:Cancer biomarker discovery constitutes a frontier in cancer research. In recent years, cell-binding aptamers have become useful molecular probes for biomarker discovery. However, there are few successful examples, and the critical barrier resides in the identification of the cell-surface protein targets for the aptamers, where only a limited number of aptamer targets have been identified so far. Herein, we developed a universal SILAC-based quantitative proteomic method for target discovery of cell-binding aptamers. The method allowed for distinguishing specific aptamer-binding proteins from non-specific proteins based on abundance ratios of proteins bound to aptamer-carrying bait and control bait. In addition, we employed fluorescently labeled aptamers for monitoring and optimizing the binding conditions. We were able to identify and validate selectin L and integrin 4 as the protein targets for two previously reported aptamers, Sgc-3b and Sgc-4e, respectively. This strategy should be generally applicable for the discovery of protein targets for other cell-binding aptamers, which will promote the applications of these aptamers.
2022-02-28 | PXD002480 | Pride