Gene expression profile at single cell level of 4T1 WT and Mga KO tumors derived on BALB/c mice
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1050292 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR27151677_1.fastq.gz | Fastqsanger.gz | |||
| SRR27151677_2.fastq.gz | Fastqsanger.gz | |||
| SRR27151678_1.fastq.gz | Fastqsanger.gz | |||
| SRR27151678_2.fastq.gz | Fastqsanger.gz | |||
| SRR27151679_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 12 |
Similar Datasets
Project description:Immune evasion is critical for tumor initiation and progression, as well as determining the efficacy of immunotherapies. Through iterative in vivo CRISPR screens within seven syngeneic tumor models, we not only identified the core immune evasion pathways and context-dependent ones across cancer types but also provided a high-confidence valuable dataset for understanding tumor intrinsic immunomodulators and discovering novel anti-cancer therapeutic targets. With a focus on triple-negative breast cancer (TNBC), we found that Mga knock-out significantly enhances anti-tumor immunity and inhibits the tumor growth of TNBC model. Transcriptomics and single cell-RNA (sc-RNA) seq analyses revealed Mga function through, at least partially, repression of MHC-II genes and related immune responses. Consistently, we observed that low MGA expression in breast cancer patients correlates with a favorable prognosis, particularly in those with active interferon-g signaling. Our findings provide new insights into tumor immune escape and pave the way for further exploration of MGA inhibition for clinical benefits in triple-negative breast cancer.
2024-09-06 | GSE249758 | GEO
Project description:scRNA-seq was performed on immune cells isolated from 4T1 BALB/c tumors to investigate their response to various treatments.
2025-03-05 | GSE226922 | GEO
Project description:4T1 mouse mammary carcinoma cells have an autocrine FGFR active loop leading to constitutive activation of downstream signaling pathways. We found that FGFR inhibitors have a strong effect on 4T1 tumors in-vivo. We used microarray to understand the contribution of FGFR signaling to the tumor formation upon TKI258 treatment. 4T1 cells were injected in the 4th mammary gland of Balb/C mice. After 7 days, daily treatment with TKI258 or water was performed for 14 days. At the end of the experiment, the RNA were extracted from three individual tumors per condition and hybridized on Affimetrix microarrays.
2010-07-07 | E-GEOD-19221 | biostudies-arrayexpress
Project description:The transcriptional regulator Mga of Streptococcus pyogenes (the group A streptococcus, GAS) is known to directly activate several virulence genes important for colonization and immune evasion during exponential growth. Transcriptome analysis comparing two mga-1 serotypes (M1 SF370, M6 JRS4) and one mga-2 serotype (M4 GA40634) against their isogenic mga-inactivated strains uncovered a broader Mga regulon profile containing both activated and repressed genes with predicted functions primarily related to the uptake and metabolism of sugars. Although the divergent M1 and M4 Mga profiles were similar in size and content, the M6 JRS4 strain was clearly distinct, even from other M6 strains. Real-time RT-PCR and northern blot analysis validated our microarray results and confirmed that established core Mga regulon genes directly activated by Mga (emm, scpA, sof, fba) exhibited the highest activation levels across all strains tested. A novel ORF (Spy2036) encoding a cytosolic hypothetical protein was highly activated in all three serotypes and was called gene regulated by Mga or grm. Mga was shown to bind directly to Pgrm, which overlaps the Mga-regulated Psof in OF+ strains, suggesting that grm is part of the core Mga regulon and is able to activate two divergently transcribed genes from a single site in a class II background. Both class and serotype specific Mga-regulated genes, such as speB, were apparent. In fact, Mga activated speB as long as it was expressed in the wild type strain, although direct binding of Mga to the PspeB promoter could not be demonstrated. Thus, Mga is able to both directly and indirectly regulate genes shown to be important for virulence and the metabolic homeostasis of GAS. Keywords: Wild-type vs Mga-
2006-08-31 | GSE4596 | GEO
Project description:The transcriptional regulator Mga of Streptococcus pyogenes (the group A streptococcus, GAS) is known to directly activate several virulence genes important for colonization and immune evasion during exponential growth. Transcriptome analysis comparing two mga-1 serotypes (M1 SF370, M6 JRS4) and one mga-2 serotype (M4 GA40634) against their isogenic mga-inactivated strains uncovered a broader Mga regulon profile containing both activated and repressed genes with predicted functions primarily related to the uptake and metabolism of sugars. Although the divergent M1 and M4 Mga profiles were similar in size and content, the M6 JRS4 strain was clearly distinct, even from other M6 strains. Real-time RT-PCR and northern blot analysis validated our microarray results and confirmed that established core Mga regulon genes directly activated by Mga (emm, scpA, sof, fba) exhibited the highest activation levels across all strains tested. A novel ORF (Spy2036) encoding a cytosolic hypothetical protein was highly activated in all three serotypes and was called gene regulated by Mga or grm. Mga was shown to bind directly to Pgrm, which overlaps the Mga-regulated Psof in OF+ strains, suggesting that grm is part of the core Mga regulon and is able to activate two divergently transcribed genes from a single site in a class II background. Both class and serotype specific Mga-regulated genes, such as speB, were apparent. In fact, Mga activated speB as long as it was expressed in the wild type strain, although direct binding of Mga to the PspeB promoter could not be demonstrated. Thus, Mga is able to both directly and indirectly regulate genes shown to be important for virulence and the metabolic homeostasis of GAS. Keywords: Wild-type vs Mga-
2006-08-31 | GSE4598 | GEO
Project description:The transcriptional regulator Mga of Streptococcus pyogenes (the group A streptococcus, GAS) is known to directly activate several virulence genes important for colonization and immune evasion during exponential growth. Transcriptome analysis comparing two mga-1 serotypes (M1 SF370, M6 JRS4) and one mga-2 serotype (M4 GA40634) against their isogenic mga-inactivated strains uncovered a broader Mga regulon profile containing both activated and repressed genes with predicted functions primarily related to the uptake and metabolism of sugars. Although the divergent M1 and M4 Mga profiles were similar in size and content, the M6 JRS4 strain was clearly distinct, even from other M6 strains. Real-time RT-PCR and northern blot analysis validated our microarray results and confirmed that established core Mga regulon genes directly activated by Mga (emm, scpA, sof, fba) exhibited the highest activation levels across all strains tested. A novel ORF (Spy2036) encoding a cytosolic hypothetical protein was highly activated in all three serotypes and was called gene regulated by Mga or grm. Mga was shown to bind directly to Pgrm, which overlaps the Mga-regulated Psof in OF+ strains, suggesting that grm is part of the core Mga regulon and is able to activate two divergently transcribed genes from a single site in a class II background. Both class and serotype specific Mga-regulated genes, such as speB, were apparent. In fact, Mga activated speB as long as it was expressed in the wild type strain, although direct binding of Mga to the PspeB promoter could not be demonstrated. Thus, Mga is able to both directly and indirectly regulate genes shown to be important for virulence and the metabolic homeostasis of GAS. Keywords: Wild-type vs Mga-
2006-08-31 | GSE4597 | GEO
Project description:Gan mice express Wnt1, Ptgs2, and Ptges, which develop inflammation-associated gastric tumors (Oshima et al, Gastroenterology 131: 1086, 2006). We examined the role of TNF-alpha in tumorigenesis by construction of TNF-/- Gan mice. We also examined genetic background difference in tumor phenotype by changing Gan mouse background from C57BL/6(B6) to BALB/c. Microarray analyses were performed to examine changes of expression profiles in tumors by TNF gene disruption or by changing genetic background. Total RNA was prepared from B6 Gan mice (n=3: Gan1-Gan3), B6-Gan TNF-/- mice (n=3: Gan(TNF KO)1-Gan(TNF KO)3), BALB-Gan mice (n=3: Gan(BALB/c)1-Gan(BALB/c)3), and wid-type normal glandular stomach (n=3: WT1-WT3). We used Affymetrix microarrays for hybridization, and examined expression profiles.
2012-12-27 | E-GEOD-43145 | biostudies-arrayexpress
Project description:Analysis of uPA regulation of 4T1 tumor growth at gene expression level. The hypothesis tested in the present study was that overexpression of uPA in 4T1 tumor influence the tumor growth and metastasis related cell signaling pathway. 4T1 cells were stably transduced by lentiviral vector expressing mouse uPA or empty vector. After day 7 of inoculation of 4T1 cells into fatpad of Balb/c mice. Total RNA was extracted from tumor samples (triplicate) using Qiagen total RNA isolation kit. The Illumina MouseWG-6 v2.0 Expression BeadChip (Illumina, Wallingford, CT) was used for gene expression. The raw data from the fluorescence intensity measurements of each array experiment was processed using GeneSpringGX v.11.0 software (Agilent, Santa Clara, CA). Statistical analysis, fold change calculations, and hierarchical clustering of the data were also performed in GeneSpring software. Genes that expressed significantly differently with more than 1.5-fold change and a p-value of <0.05 with respect to controls were taken into consideration. Gene expression data were further validated by qRT-PCR analysis. Pathway analysis was performed by MetaCore software (GeneGo, Inc, St. Joseph, MI).
2012-05-30 | E-GEOD-38346 | biostudies-arrayexpress
Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.
2023-12-18 | GSE202685 | GEO